Dataset for CDS PMAIP1 of organism Loxodonta africana

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|G3T0P7_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Loxodonta africana GN=PMAIP1 (length=177 residues).
atgccggggaagaaggcacgcaagagcgcgcagcccggccctgccgggaccccggcaggtactcaacagcgcgatgttgt
cgagtgtgctattcaactcaggagaattggagacaaaattaatttccggcagaaacttctgaatgtgatatgcaagctct
tctgctcaggcacctga
© 1998-2018