Dataset for CDS classical BH3-containing proteins of organism Loxodonta africana

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|G3SU55_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Loxodonta africana GN=BCL2L11 (length=591 residues).
atggcaaagcaaccttcagatgtaagttctgagtgtgacagagaaggtggacagttacagcctgcggagaggcccccgca
gcctcctcagctcaggcctggggcccctacctctctgctcacggagcctcaaggtaatcctgacggtgaaggggacagct
gcccccagggcagcccacagggcccgcaggccccaccagccagccccggcccttttgctaccagatccccgcttttcatc
tttgtgagaagatcctccctgctgtctcgatcctccagcgggtatttctcttttgacacagacaggagcccagcacccat
gagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccatcaaccattacctcagtgcaatggcttccatga
ggcagtctcaggctctacctgcagacctgcgcccggagatctggattgcgcgagagctacggcgcattggagacgaattc
aatgcctactacccaaggagggcttttttgaataattaccaagcagccgaagaccaccctcaaatggttatcttacgtct
cttacgctacatcgtccgcctggtgtggaga
>gnl|bcl2dbcds|G3T0P7_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Loxodonta africana GN=PMAIP1 (length=177 residues).
atgccggggaagaaggcacgcaagagcgcgcagcccggccctgccgggaccccggcaggtactcaacagcgcgatgttgt
cgagtgtgctattcaactcaggagaattggagacaaaattaatttccggcagaaacttctgaatgtgatatgcaagctct
tctgctcaggcacctga
>gnl|bcl2dbcds|G3T2N1_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Loxodonta africana GN=BBC3 (length=561 residues).
atggcccgcgcacgccaggagggcagctcccccgagcccgtagagggtctggcccgcgagagcccgcgccccttcccact
cggcagcctggtgccctcggccgtgtcctgtggcctctgcgagcccggccttcctcgagttgcagggccacggctccttc
cggggcctcggacacagctgtttcccagcccctctccagtctgggtctctgatctctcgggactgcagttggagagaggt
ggggccgagtgggaggacagggcccctcgtcctctctcaggtcctcagccctcactctcgccggcggagcagcacctgga
gtcgccggtgcccacgcaggcggccccgggggtccggggagaggatgagcaatgggcccgagagatcggggcccagtttc
ggcggaaggcggacgacctctatgcgctgtacgagcggtcggtgagacaggaggagcagcaccggcaccgtccctcgccc
tggagggtcctgtacaatctcatcatgggactactgcccttaccaagggaccatggcgcccccgagatggagcccaatta
g
>gnl|bcl2dbcds|G3T7Z4_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Loxodonta africana GN=BMF (length=807 residues).
atgccccgagcgggggtattttggaaacaataccgcacggtgttgagtctcgtccaccagcgcccgccagcgcttgctgc
cgccgccgtccgttcgccgcgcctgccgccgctgcccgctgagctttttccctccttcccaatcgaatctgggcgccaag
ccccccgagtgctcgtcacgctggaccctggcgcggagccctggcgtcacgacccggagactgacactctttcctggagt
cacccaggggagatggagccatctcagtgtgtggaggagctggaggatgatgtattccaaccagaggagggggagcctgg
gacccagcccgggggcttgctctctgctgacctgtttgcccagagccagctggactgccccctcagccggcttcagctct
tccctctcacccactgctgtggccctgggcttcgacacaccagccaggaggacaaggcaactcagactctcagcccagcc
tccccaagccagggtgtcatgctgccttgtggggtgaccgaggaaccccagcgactcttttatggcaatgctggctaccg
gctccctctccctgccagtttccctgcaggcttgccacttggggagcagccccctgaagggcagtggcaacatcgagcag
aggtacagattgcccgaaagcttcagtgcattgcagaccacttccaccggcttcatatgcagcggcaccagcagaaccga
aatcctgcgtggaggcagattctccaattcctgcaccaccttgctgtgaacggggaggagaacaggaatggggcaggtcc
taggtga
>gnl|bcl2dbcds|G3TP47_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Loxodonta africana GN=BAD (length=621 residues).
ggacccccagagaatccctcaccggcttccacacacgcccaaggcgtgaggatgtcgggagctgaacatccggagaagaa
gaagggacgcaggagatcatcgggcgggctgcagagtatgttccagatcccagagtttgagcagagtgaccgggaagact
ccacccctgcagacaggggcctgggccccagccccgaagggtactggccttcaggccccagcgaccgccaccgtgtggcc
ccaggcttcctgcgggactccagtcaccagcaggggcagccgaccagcagcggccaccatggaggtgctgcggctgtgga
gacccggagtcgccacagctcataccccgcagggtctgatgaggctgaagggctggaggaggatcccagcccctttcggg
gtcgctcgctttcagcgccccccaacctctgggctgcacagagatatggccgtgagctccgcaggatgagtgatgagttc
cagggctatttcaagggacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggcaaagccccagctggacacg
catcatccaggcctggtgggatcggaatttggggagaggcagctccgccccgtctcagtga
>gnl|bcl2dbcds|G3UH24_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Loxodonta africana GN=HRK (length=273 residues).
atgtgtccgtgccccctgcaccgtggccgcggccccccggccgtgtgcgcctgcagcgcaggtcgcctgggtctgcgctc
gtccgccgcgcagctcaccgctgctcggctcaaggcgcttggagacgagctgcaccagcgcaccatgtggcggcgtcgcg
cgaggagccggagggcgccggcgcccggcgcgctccccacctactggccctggctgtgcgcggcggcgcaggtggcggcg
ctggcggcctggctgctccgcaggcggaacttg
© 1998-2018