Dataset for CDS BBC3 of organism Loxodonta africana

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|G3T2N1_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Loxodonta africana GN=BBC3 (length=561 residues).
atggcccgcgcacgccaggagggcagctcccccgagcccgtagagggtctggcccgcgagagcccgcgccccttcccact
cggcagcctggtgccctcggccgtgtcctgtggcctctgcgagcccggccttcctcgagttgcagggccacggctccttc
cggggcctcggacacagctgtttcccagcccctctccagtctgggtctctgatctctcgggactgcagttggagagaggt
ggggccgagtgggaggacagggcccctcgtcctctctcaggtcctcagccctcactctcgccggcggagcagcacctgga
gtcgccggtgcccacgcaggcggccccgggggtccggggagaggatgagcaatgggcccgagagatcggggcccagtttc
ggcggaaggcggacgacctctatgcgctgtacgagcggtcggtgagacaggaggagcagcaccggcaccgtccctcgccc
tggagggtcctgtacaatctcatcatgggactactgcccttaccaagggaccatggcgcccccgagatggagcccaatta
g
© 1998-2018