Dataset for CDS classical BH3-containing proteins of organism Lithobates catesbeiana

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|C1C3S9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Lithobates catesbeiana GN=BAD (length=453 residues).
atgggggattctcctcataagtctatgtttagtattgaagagtttccaccgacagaaagggggtctgcattttctggaac
aaatcctccaggttttggaggagatcctggacacaagagttcccctaacttgagacgaataaaaggaaaagaaactcggc
aacggacagaatctgcttcagaagcctcagagacggacagtgttggagagcttcaacatttccgctcacgttcccgctct
gctccatcttctctaatggttgcagctcgatatggacgagagctgaggcgaatgagtgatgaattcgaccaaatcttcac
gagtatccctcgacctaaaagtgcaagtgcagccactgagatgaccgttagcaagagtttcggagaaacattttttaact
tctttagaagaaagaacaaagaccgaagtcagtcagaaaacgacaagcactga
© 1998-2018