Dataset for CDS BMF of organism Lepisosteus oculatus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|W5N4P7_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Lepisosteus oculatus GN=BMF (length=462 residues).
atggaagaggatgaagatgacgtgttccacccgtcacatttctcacactgctggggaacccaattcagggaaataaagta
cgaggacaagggcacgcagacgccaagtccagccttggtacatggtgacaacatgttgccgtgtggtgtcggagcagagc
ctcgccgactcttctatggtaatgctgcctttcgattgcacttccctgcacattttgaacagggcggggatgaggaagag
gagacgggtgaagctgaggagcagccggtgcggagtgctgaggttcgaataggccaaaagctccagaggataggagatca
gtttcaccgagactatctccacatgtaccgcagaaaccaaaggaaccaccagcccatgtggtggaggctggctttggctt
tgttcacattcctgtttgagagacaagggaacaggaaccaacttcgtggtgaccagaggtga
© 1998-2018