Dataset for CDS BAD of organism Latimeria chalumnae

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|H3ANP3_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Latimeria chalumnae GN=BAD (length=522 residues).
atgttccagatttcagactccgactcagacgcgtacgaagatgatagaacgggccccttgccactgcagtctggaggagg
aagaggcgagggatcagagccaagtgaaaaaacagcgggtttaaagaaacacagccggacagcccccaatctgcagaacc
cgggacctcaccagagccaccccccttctcacacagataacatggagattctggggcgtccaagttccgagtcccagatc
tcagactcagaatcactggatgagcttggccctttcaggacaaggtctcgttccgcaccacctaacttctgggccgcaag
gaagtacgggcaagaactgcggagaatgagcgatgaattcgacatgtcctttctggggcttccgaggccaaagagcgctg
gagcagctggagaaatggtggacgagagctggtggaagaaactgatacgctctctaaaggggcgcgggcaacccagggac
ccgcctgggcaacagggagtgtcgatccgaggacctgactaa
>gnl|bcl2dbcds|H3ANP3_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Latimeria chalumnae GN=BAD (length=522 residues).
atgttccagatttcagactccgactcagacgcgtacgaagatgatagaacgggccccttgccactgcagtctggaggagg
aagaggcgagggatcagagccaagtgaaaaaacagcgggtttaaagaaacacagccggacagcccccaatctgcagaacc
cgggacctcaccagagccaccccccttctcacacagataacatggagattctggggcgtccaagttccgagtcccagatc
tcagactcagaatcactggatgagcttggccctttcaggacaaggtctcgttccgcaccacctaacttctgggccgcaag
gaagtacgggcaagaactgcggagaatgagcgatgaattcgacatgtcctttctggggcttccgaggccaaagagcgctg
gagcagctggagaaatggtggacgagagctggtggaagaaactgatacgctctctaaaggggcgcgggcaacccagggac
ccgcctgggcaacagggagtgtcgatccgaggacctgactaa
>gnl|bcl2dbcds|H3ANP3_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Latimeria chalumnae GN=BAD (length=525 residues).
atgttccagatttcagactccgactcagacgcgtacgaagatgatagaacgggccccttgccactgcagtctggaggagg
aagaggcgagggatcagagccaagtgaaaaaacagcgggtttaaagaaacacagccggacagcccccaatctgcagaacc
cgggacctcaccagagccaccccccttctcacacaggtgtatacggttgggtaaaacttaggaagcgaaataacatggag
attctggggcgtccaagttccgagtcccagatctcagactcagaatcactggatgagcttggccctttcaggacaaggtc
tcgttccgcaccacctaacttctgggccgcaaggaagtacgggcaagaactgcggagaatgagcgatgaattcgacatgt
cctttctggggcttccgaggccaaagagcgctggagcagctggagaaatggtggacgagagctggtggaagaaactgata
cgctctctaaaggggcgcgggcaacccagggacccgcctgggcaa
>gnl|bcl2dbcds|H3ANP3_BAD-04 BCL2-associated agonist of cell death gene OS=[Eukaryota] Latimeria chalumnae GN=BAD (length=510 residues).
atgttccagatttcagactccgactcagacgcgtacgaagatgatagaacgggccccttgccactgcagtctggaggagg
aagaggcgagggatcagagccaagtgaaaaaacagcgggtttaaagaaacacagccggacagcccccaatctgcagaacc
cgggacctcaccagagccaccccccttctcacacagttttttggggatttacagataacatggagattctggggcgtcca
agttccgagtcccagatctcagactcagaatcactggatgagcttggccctttcaggacaaggtctcgttccgcaccacc
taacttctgggccgcaaggaagtacgggcaagaactgcggagaatgagcgatgaattcgacatgtcctttctggggcttc
cgaggccaaagagcgctggagcagctggagaaatggtggacgagagctggtggaagaaactgatacgctctctaaagggg
cgcgggcaacccagggacccgcctgggcaa
© 1998-2018