Dataset for CDS classical BH3-containing proteins of organism Labrus bergylta

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A3Q3ESW6_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Labrus bergylta GN=BCL2L11 (length=714 residues).
atgcaccgtccgtccagaccaccgaaccggttggatggctcgcccacagtaacggaatcacacgggaccagaggagatcc
accacaaacctcccgttcagacaacagcggggggcgaaactttggccgcaccgattccacgggaggaggagagccggact
caccgtcccggtgcagattcaaaccagtctcccctgtggacagcctcggcgtgttccagaagagatctatatttcacctt
cctcgccgcgcctcgagtggatacttctcctacgacggagactcgctgccgagctctccgctctccccgaggccgctgac
ggctgacaaagccacgcagactcccagccccagtggccaggtgatgcaacacgctctgcagcgcatgactgaggcgcacg
gaggaggaccggggacgcagcagcagtacgggcactctcccagcctcactagccggcgacaacggactgcagcaggggac
atgcaggcggaggctattggacgagatctccaacgcattggcgacgactataatagactactgctatggagaatggcagg
tagacatggtcggcctgaggtccatccaaacccgcagccgcacatccaaccggagcccaccatgctgctgtgtacgggtc
tcatgatccttctgattggatggattatctacttgcgaggcaatacaaacagccatgaccactctcaggtgtag
>gnl|bcl2dbcds|A0A3Q3GUU5_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Labrus bergylta GN=BMF (length=474 residues).
atggacgatgaagaggatgatgtgttcgagccggacccacacagctggcgcacctattttcaggagataaagtgtgaaga
ccggggcacgcagacacctggcccggccctggcacccaacaacggcatgctgccctgtggagtcgcagaggagcccagac
cactcttctacggcaacgcaggttttcgattacacttccctgcaaactttgagcttgttggggatcaggaagagagcgga
caagaaagcgagctgcagcaaattgggatggagcagcagcaacctgttgcccacagtgtggaggccagcatcggtctgaa
actccaactcataggagaccagtttcatcgggaacacttacaactgtatcatcgaaaccaaaggaaccaggggcctctgt
ggtggcgtctgggtgcagctttgctgagccttctgtttgacaggggcttcatcgctggagcaggacggaggtga
>gnl|bcl2dbcds|A0A3Q3MLA0_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Labrus bergylta GN=BAD (length=666 residues).
atgaagtgtaacaacaagtgttatcattttataagacttgtttttgtcaaaaagcagtcggttatctgcgcaggttacgg
cactgtgaatacctttggaccggcttacagcagggacagcacagagaataagatatcctgcttgggtgtgttagatgtca
cgatggctgcgaagttcactatttcagacagtgagtccgggtcagaagaggaggtaaaagaggaagagaacgaccaatca
tcagctgtggaagagccgcatgttccccaacgacacagcttaaccctaccagagctcagactggcagggactggtcggat
caggttgaactcagagtcccacgcttacaccgtctccagggacgaagagctccaggccaggggggaagaagaggctggca
cccccacggaaggagcgccattcaggggacgatcaaaatcggctccccctgccttgtgggcagctaaaaaatacggccgg
cagctccggaggatgagcgacgagtttgacatcctgcttgacaaaggggagatgaaaaaagtaagaagccctgggccagc
caaacagatgcaccactccaagagttggtggagctacctcttcagccaccaggagacagagggagagaacaaccaccacg
aaaaccacacccaccgcaatgagtaa
>gnl|bcl2dbcds|A0A3Q3MLA0_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Labrus bergylta GN=BAD (length=561 residues).
atggctgcgaagttcactatttcagacagtgagtccgggtcagaagaggaggtaaaagaggaagagaacgaccaatcatc
agctgtggaagagccgcatgttccccaacgacacagcttaaccctaccagagctcagactggcagggactggtcggatca
ggttgaactcagagtcccacgcttacaccgtctccagggacgaagagctccaggccaggggggaagaagaggctggcacc
cccacggaaggagcgccattcaggggacgatcaaaatcggctccccctgccttgtgggcagctaaaaaatacggccggca
gctccggaggatgagcgacgagtttgacatcctgcttgacaaaggggtgagaattaaaggggggggggggggtagcaggg
gtggctgtggattagtggtggagtcggtcgtctctcaaccgaaaagtcaggagttcaatacccagctcctgcagccacat
gtccgatgtgtccttgggtccttgaatgtgtataaatgggattacctaatactgatcatcactttacacagcagcctcta
g
>gnl|bcl2dbcds|A0A3Q3MLA0_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Labrus bergylta GN=BAD (length=588 residues).
atgacactaacagcaagtgatgtcacgatggctgcgaagttcactatttcagacagtgagtccgggtcagaagaggaggt
aaaagaggaagagaacgaccaatcatcagctgtggaagagccgcatgttccccaacgacacagcttaaccctaccagagc
tcagactggcagggactggtcggatcaggttgaactcagagtcccacgcttacaccgtctccagggacgaagagctccag
gccaggggggaagaagaggctggcacccccacggaaggagcgccattcaggggacgatcaaaatcggctccccctgcctt
gtgggcagctaaaaaatacggccggcagctccggaggatgagcgacgagtttgacatcctgcttgacaaaggggtgagaa
ttaaaggggggggggggggtagcaggggtggctgtggattagtggtggagtcggtcgtctctcaaccgaaaagtcaggag
ttcaatacccagctcctgcagccacatgtccgatgtgtccttgggtccttgaatgtgtataaatgggattacctaatact
gatcatcactttacacagcagcctctag
© 1998-2019