Dataset for CDS BMF of organism Labrus bergylta

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3Q3GUU5_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Labrus bergylta GN=BMF (length=474 residues).
atggacgatgaagaggatgatgtgttcgagccggacccacacagctggcgcacctattttcaggagataaagtgtgaaga
ccggggcacgcagacacctggcccggccctggcacccaacaacggcatgctgccctgtggagtcgcagaggagcccagac
cactcttctacggcaacgcaggttttcgattacacttccctgcaaactttgagcttgttggggatcaggaagagagcgga
caagaaagcgagctgcagcaaattgggatggagcagcagcaacctgttgcccacagtgtggaggccagcatcggtctgaa
actccaactcataggagaccagtttcatcgggaacacttacaactgtatcatcgaaaccaaaggaaccaggggcctctgt
ggtggcgtctgggtgcagctttgctgagccttctgtttgacaggggcttcatcgctggagcaggacggaggtga
© 1998-2019