Dataset for CDS classical BH3-containing proteins of organism Kryptolebias marmoratus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A3Q2ZA20_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Kryptolebias marmoratus GN=BMF (length=492 residues).
atggacgatgaggaggatgatgtgtttgagccagatcccagctgctggcgcacgactttcagggagataaagtgcgaaga
ccggggcacacagacacccggtcctgccctggtaccacacagcggcatgctgccctgtggagtcgcagaggagcccagac
cactattctacggtaacgcaggttttcgattgcacttcccagctcgcttcgaactcatcagggatcttgaagcgaggcaa
caagacagggaagaggagccaaacaggatggagcggctgccccggcagctgcccgtggcgcgcagcttggaagtttgtat
tggacagaaactccagctgataggagaccagtttcaccgggaacacttgcagcagtatcatcgaaaccaaaggaaccagg
ggccgctgtggtggcgcctgactgcagctctcctcagccttctgtttgatagggggttcattgcgggaggagggggtgca
ggacggaggtga
>gnl|bcl2dbcds|A0A3Q3AEL8_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Kryptolebias marmoratus GN=BAD (length=501 residues).
atggctgcaaagttcaccatttcagacagcgagtcggagccctcagacgaggtagaggagggaaagagcaaacagccggc
agcgggaccggaggacggcgtccgccagcgcctcaccctgcccgagctcaggcattcaaagaacggccggctcagggtga
actcggagtcgctctcctccaccagctccaggggggaggaggagctcccggcgcgggcagacgacgagcccgggaccccc
accgaggggtatccgttcagggggcgatccaagtcggcccctccagccctgtgggccgccaagaagtacggccggcagct
ccgccggatgagcgacgagttcgacagcctgctcgacaagggggagatgaggaaggtgaagagcgccgggacgaccaaac
agatacaccactcccgaagctggtggaactacctctttagtcaccaggagacggacggcgagagcagccaccacgagaag
ccgacccaccgcaccgagtaa
>gnl|bcl2dbcds|A0A3Q3AEL8_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Kryptolebias marmoratus GN=BAD (length=501 residues).
atggctgcaaagttcaccatttcagacagcgagtcggagccctcagacgaggtagaggagggaaagagcaaacagccggc
agcgggaccggaggacggcgtccgccagcgcctcaccctgcccgagctcaggcattcaaagaacggccggctcagggtga
actcggagtcgctctcctccaccagctccaggggggaggaggagctcccggcgcgggcagacgacgagcccgggaccccc
accgaggggtatccgttcagggggcgatccaagtcggcccctccagccctgtgggccgccaagaagtacggccggcagct
ccgccggatgagcgacgagttcgacagcctgctcgacaagggggagatgaggaaggtgaagagcgccgggacgaccaaac
agatacaccactcccgaagctggtggaactacctctttagtcaccaggagacggacggcgagagcagccaccacgagaag
ccgacccaccgcaccgagtaa
>gnl|bcl2dbcds|A0A3Q3B113_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Kryptolebias marmoratus GN=BCL2L11 (length=717 residues).
atgcgtagtccatccagaccgccaaatctgcgcgatggctcgaccgaagtaaaggcaacagagggcagcagcggaggagc
tccaccgtccgccggcgccgctcgaggctcggcgcacgcgacccgtccggtccgcggcagagcgccgagcgccgcgggag
gagagcccgagtcgccggcctgctcctccaacccccccgctggcttagacgtgtttcggagcaggtcgatatttcgcttc
ccccggcgctcgtccagcggctacttctctttcgagggcgactcgctgccgagctctccgctctcgccgaagccagtgac
ggcggagaaagccacgcagacgcccagccccaccggccaggtgatgaaccacgccctgcagcgaatggctgtggagcagg
gaggaggaccggggacgcaccggctgcacggaagctctcccaacccctctggcacgcaggcacgaaacgcagcaggggac
atggaggcagagtcattcggacgtcatctccggaccattggggatgagtacaataggcttttacttttaaggaggatggc
aggccgacccagacgaaacatcgttcctctgaacctcctgccacacatccaccaggagcctgtcgccatgctctgcgtga
gcctcctgctcctcctgattggacggctcatgtacttacaaggctgcacaaacagccagaataattctcaggtttag
© 1998-2019