Dataset for CDS classical BH3-containing proteins of organism Ictidomys tridecemlineatus

[Download (right click)] [Alignment] [Repertoires]

7 sequence(s)

>gnl|bcl2dbcds|A0A287DFJ0_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL2L11 (length=588 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgcagagaggcctcccca
gctcaggccgggggcccctacctcccttcagacagagcctcaaggtaatcccgaaggcgaaggggaccgctgcccccacg
gcagcccacagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttcatctttgtgaga
agatcttccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctgagtgcaatggcttccatgcgggagtctc
aggcagaacctgcagacatgcgcccggagatctggatcgcgcaggagctgcggcgaatcggagatgagtttaacctgtat
tacccacggagggtattttttaataattaccaacctgaagaccgcccccaaatggttatcttgcgcctgttgcgttgcat
catccgcctggtgtggaggatgcactga
>gnl|bcl2dbcds|A0A287DFJ0_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL2L11 (length=420 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgacagagaaggtggacaattgcagcctgcagagaggcctcccca
gctcaggccgggggcccctacctcccttcagacagagcctcaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctgagtgcaatggcttccatgcgggagtctcaggcagaa
cctgcagacatgcgcccggagatctggatcgcgcaggagctgcggcgaatcggagatgagtttaacctgtattacccacg
gagggtattttttaataattaccaacctgaagaccgcccccaaatggttatcttgcgcctgttgcgttgcatcatccgcc
tggtgtggaggatgcactga
>gnl|bcl2dbcds|I3LVX0_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BIK (length=324 residues).
atggttcagggcagtcaccaggtggccctgcgactggcctgcattggggatgagatggatctgtgttttcaggacctcca
actggcccagctgcctgggatggccatgcacagccttgctctcagctacagccaggcgagagtcacgggtgtgctcagaa
gcttggcccagggtctcgccagcctcagggagaacatgtggttctggagacctgcagcccccagcacccgggtgcctcct
gcccgggcctgccgggagctgctgcccgtgctgctgctgctgggcctgttgctgagcagggccctgtacctgcggctcca
gtga
>gnl|bcl2dbcds|I3MBM5_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BAD (length=627 residues).
atggggatcccagaaaaagccctcatcgcttccacgcacgctccaggcgcgaggaagtcagggaaggagggaccggggag
gaaggcggtaggacccgcaggtcggcggcgagggtggcacccggcctggacccagagcatgttccagatcccagagtttg
agcccagtgagcaggaagactccagctccgcagaagggggcctgggccccagccccgcaggggaccggccaggctgcggc
ttggctccaggcctccccagggacacgggtcaccagcagtggcaggcaaccagcagcagcaaccatggaggcgctggggc
tacggagacccggagtcgccacagctcgtaccccgcagataccgatttggatgaagggatggaagaggagcccagcccct
tccgcggccgctcgcgctcggcgccccccaatctctgggctgcacagcgctacggccgcgagctccggaggatgagcgac
gaattcgagggctcctttaagggacttcctcgcccgaggagcgcaggcacagcgtcgcagatgcggcaaagctccagctg
gacgcgcttcatccagtcctggtgggatcggaacttggggaggcgaggctccgccccctcccagtga
>gnl|bcl2dbcds|I3MBM5_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BAD (length=537 residues).
atggggatcccagaaaaagccctcatcgcttccacgcacgctccaggcgcgaggaagtcagggaaggagggaccggggag
gaaggcggtaggacccgcaggtcggcggcgagggtggcacccggcctggacccagagcatgttccagatcccagagtttg
agcccagtgagcaggaagactccagctccgcagaagggggcctgggccccagccccgcaggggaccggccaggctgcggc
ttggctccaggcctccccagggacacgggtcaccagcagtggcaggcaaccagcagcagcaaccatggaggcgctggggc
tacggagacccggagtcgccacagctcgtaccccgcagataccgatttggatgaagggatggaagaggagcccagcccct
tccgcggccgctcgcgctcggcgccccccaatctctgggctgcacagcgctacggccgcgagctccggaggatgagcgac
gaattcgagggctcctttaaggtgacattttcccagtccccattcctgagggcctaa
>gnl|bcl2dbcds|I3MDS9_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BMF (length=570 residues).
gttttcccagaggagatggagccgcctcagtgtgtggaggagctggaagatgatgtgttccagccagaggatggggagcc
agggacccagcctgggagcttgctctctgctgacttgtttgcccagagccagctggactgccccctcagcaggcttcagc
tcttccctctcacccactgctgtggtcctgggcttcgacctaccagccaggaagacaaggccactcagaccctcagccca
gcctccccaagccagggtgtcatgctgccttgtggagtgactgaagaaccccagcgactcttttatggcaatgctggcta
ccggcttcctctccctgctagtttccctgcaggcttgccccttggagagcagccccctgaaggtcagtggcaacatcgag
cagaggtacagatcgcccgaaaacttcagtgcattgcagaccagttccaccggcttcatatgcagcaacaccagcagaac
cgaaatcgtgtgtggtggcagattctcctcttcctgcacaacctggcattaaatggagatgagaacagggaccgggcagg
tcctaggtga
>gnl|bcl2dbcds|I3MDS9_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BMF (length=777 residues).
atgccccgagcgggcgtattttggaaacaataccgcgcggtgcgcagtggcctcctccggcgcccgccagagtccgcagc
cgccgccggccctgccagcggctcccgcctccctgggagcggagtctcgctcccccaagtgttcatcacgctggaccctg
gcgcagagccctggcatcacgactcggaggccgagactctctcctggagtcacccaggtgagatggagccgcctcagtgt
gtggaggagctggaagatgatgtgttccagccagaggatggggagccagggacccagcctgggagcttgctctctgctga
cttgtttgcccagagccagctggactgccccctcagcaggcttcagctcttccctctcacccactgctgtggtcctgggc
ttcgacctaccagccaggaagacaaggccactcagaccctcagcccagcctccccaagccagggtgtcatgctgccttgt
ggagtgactgaagaaccccagcgactcttttatggcaatgctggctaccggcttcctctccctgctagtttccctgcagg
cttgccccttggagagcagccccctgaaggtcagtggcaacatcgagcagaggtacagatcgcccgaaaacttcagtgca
ttgcagaccagttccaccggcttcatatgcagcaacaccagcagaaccgaaatcgtgtgtggtggcagattctcctcttc
ctgcacaacctggcattaaatggagatgagaacagggaccgggcaggtcctaggtga
© 1998-2018