Dataset for CDS BMF of organism Ictidomys tridecemlineatus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|I3MDS9_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BMF (length=570 residues).
gttttcccagaggagatggagccgcctcagtgtgtggaggagctggaagatgatgtgttccagccagaggatggggagcc
agggacccagcctgggagcttgctctctgctgacttgtttgcccagagccagctggactgccccctcagcaggcttcagc
tcttccctctcacccactgctgtggtcctgggcttcgacctaccagccaggaagacaaggccactcagaccctcagccca
gcctccccaagccagggtgtcatgctgccttgtggagtgactgaagaaccccagcgactcttttatggcaatgctggcta
ccggcttcctctccctgctagtttccctgcaggcttgccccttggagagcagccccctgaaggtcagtggcaacatcgag
cagaggtacagatcgcccgaaaacttcagtgcattgcagaccagttccaccggcttcatatgcagcaacaccagcagaac
cgaaatcgtgtgtggtggcagattctcctcttcctgcacaacctggcattaaatggagatgagaacagggaccgggcagg
tcctaggtga
>gnl|bcl2dbcds|I3MDS9_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BMF (length=777 residues).
atgccccgagcgggcgtattttggaaacaataccgcgcggtgcgcagtggcctcctccggcgcccgccagagtccgcagc
cgccgccggccctgccagcggctcccgcctccctgggagcggagtctcgctcccccaagtgttcatcacgctggaccctg
gcgcagagccctggcatcacgactcggaggccgagactctctcctggagtcacccaggtgagatggagccgcctcagtgt
gtggaggagctggaagatgatgtgttccagccagaggatggggagccagggacccagcctgggagcttgctctctgctga
cttgtttgcccagagccagctggactgccccctcagcaggcttcagctcttccctctcacccactgctgtggtcctgggc
ttcgacctaccagccaggaagacaaggccactcagaccctcagcccagcctccccaagccagggtgtcatgctgccttgt
ggagtgactgaagaaccccagcgactcttttatggcaatgctggctaccggcttcctctccctgctagtttccctgcagg
cttgccccttggagagcagccccctgaaggtcagtggcaacatcgagcagaggtacagatcgcccgaaaacttcagtgca
ttgcagaccagttccaccggcttcatatgcagcaacaccagcagaaccgaaatcgtgtgtggtggcagattctcctcttc
ctgcacaacctggcattaaatggagatgagaacagggaccgggcaggtcctaggtga
© 1998-2018