Dataset for CDS BIK of organism Ictidomys tridecemlineatus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|I3LVX0_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BIK (length=324 residues).
atggttcagggcagtcaccaggtggccctgcgactggcctgcattggggatgagatggatctgtgttttcaggacctcca
actggcccagctgcctgggatggccatgcacagccttgctctcagctacagccaggcgagagtcacgggtgtgctcagaa
gcttggcccagggtctcgccagcctcagggagaacatgtggttctggagacctgcagcccccagcacccgggtgcctcct
gcccgggcctgccgggagctgctgcccgtgctgctgctgctgggcctgttgctgagcagggccctgtacctgcggctcca
gtga
© 1998-2018