Dataset for CDS BAD of organism Ictidomys tridecemlineatus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|I3MBM5_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BAD (length=627 residues).
atggggatcccagaaaaagccctcatcgcttccacgcacgctccaggcgcgaggaagtcagggaaggagggaccggggag
gaaggcggtaggacccgcaggtcggcggcgagggtggcacccggcctggacccagagcatgttccagatcccagagtttg
agcccagtgagcaggaagactccagctccgcagaagggggcctgggccccagccccgcaggggaccggccaggctgcggc
ttggctccaggcctccccagggacacgggtcaccagcagtggcaggcaaccagcagcagcaaccatggaggcgctggggc
tacggagacccggagtcgccacagctcgtaccccgcagataccgatttggatgaagggatggaagaggagcccagcccct
tccgcggccgctcgcgctcggcgccccccaatctctgggctgcacagcgctacggccgcgagctccggaggatgagcgac
gaattcgagggctcctttaagggacttcctcgcccgaggagcgcaggcacagcgtcgcagatgcggcaaagctccagctg
gacgcgcttcatccagtcctggtgggatcggaacttggggaggcgaggctccgccccctcccagtga
>gnl|bcl2dbcds|I3MBM5_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BAD (length=537 residues).
atggggatcccagaaaaagccctcatcgcttccacgcacgctccaggcgcgaggaagtcagggaaggagggaccggggag
gaaggcggtaggacccgcaggtcggcggcgagggtggcacccggcctggacccagagcatgttccagatcccagagtttg
agcccagtgagcaggaagactccagctccgcagaagggggcctgggccccagccccgcaggggaccggccaggctgcggc
ttggctccaggcctccccagggacacgggtcaccagcagtggcaggcaaccagcagcagcaaccatggaggcgctggggc
tacggagacccggagtcgccacagctcgtaccccgcagataccgatttggatgaagggatggaagaggagcccagcccct
tccgcggccgctcgcgctcggcgccccccaatctctgggctgcacagcgctacggccgcgagctccggaggatgagcgac
gaattcgagggctcctttaaggtgacattttcccagtccccattcctgagggcctaa
© 1998-2018