Dataset for CDS HRK of organism Homo sapiens

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|O00198_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Homo sapiens GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgcgggtcgcctggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgctaggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccttggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
© 1998-2018