Dataset for CDS classical BH3-containing proteins of organism Homo sapiens

[Download (right click)] [Alignment] [Repertoires]

33 sequence(s)

>gnl|bcl2dbcds|A0A0C4DH20_BCL2L11-10 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=249 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagcttccatgaggcaggctgaacctgcagatatgcgcc
cagagatatggatcgcccaagagttgcggcgtattggagacgagtttaacgcttactatgcaaggaggatgcctcttcca
cctgattaa
>gnl|bcl2dbcds|A0A0C4DH20_BCL2L11-11 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=228 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagtctcactctgtcacccaggctggagtgcactggtgc
gatcttggctcactgcaacctccaactcccaagttcaagcggttctcctgcctcagcctcccaagtag
>gnl|bcl2dbcds|A0A0C4DH20_BCL2L11-13 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=258 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagcttccatgaggcaggctgaacctgcagatatgcgcc
cagagatatggatcgcccaagagttgcggcgtattggagacgagtttaacgcttactatgcaaggaggctggcaaaactc
ctggcatcctccacctga
>gnl|bcl2dbcds|A0A0C4DH20_BCL2L11-18 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccacctgccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggtattt
ttgaataa
>gnl|bcl2dbcds|A0A0C4DH20_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=597 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccacctgccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaggctgaacctgcagatatgcgcccagagatatggatcgcccaagagttgcggcgtattggagacgagtttaac
gcttactatgcaaggagggtatttttgaataattaccaagcagccgaagaccacccacgaatggttatcttacgactgtt
acgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A0C4DH20_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=417 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccatgaggcaggctgaacctgca
gatatgcgcccagagatatggatcgcccaagagttgcggcgtattggagacgagtttaacgcttactatgcaaggagggt
atttttgaataattaccaagcagccgaagaccacccacgaatggttatcttacgactgttacgttacattgtccgcctgg
tgtggagaatgcattga
>gnl|bcl2dbcds|A0A0C4DH20_BCL2L11-23 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccacctgccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|A0A0C4DH20_BCL2L11-22 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccacctgccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggctaact
gggactag
>gnl|bcl2dbcds|A0A0C4DH20_BCL2L11-21 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=519 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccacctgccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaggctgaacctgcagatatgcgcccagagatatggatcgcccaagagttgcggcgtattggagacgagtttaac
gcttactatgcaaggaggatgcctcttccacctgattaa
>gnl|bcl2dbcds|A0A0C4DH20_BCL2L11-20 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=339 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtcatcctagaggatataggtgat
ctttcactgtgctttggatttatatttactggcttagatttgtatggccaccaccatagtcaagatacagaacaactcaa
ccacaaggatttctcatga
>gnl|bcl2dbcds|A0A0C4DH20_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=330 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccatgaggcaggctgaacctgca
gatatgcgcccagagatatggatcgcccaagagttgcggcgtattggagacgagtttaacgcttactatgcaaggaggtt
agagaaatag
>gnl|bcl2dbcds|A0A0C4DH20_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=339 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtcatcctagaggatataggtgat
ctttcactgtgctttggatttatatttactggcttagatttgtatggccaccaccatagtcaagatacagaacaactcaa
ccacaaggatttctcatga
>gnl|bcl2dbcds|A0A0C4DH20_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=243 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggttagagaaatagaggaagttgtcgtg
tag
>gnl|bcl2dbcds|A0A0C4DH20_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccacctgccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|A0A0C4DH20_BCL2L11-09 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=519 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccacctgccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaggctgaacctgcagatatgcgcccagagatatggatcgcccaagagttgcggcgtattggagacgagtttaac
gcttactatgcaaggaggatgcctcttccacctgattaa
>gnl|bcl2dbcds|A0A0C4DH20_BCL2L11-17 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=510 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccacctgccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
tgaggcaggctgaacctgcagatatgcgcccagagatatggatcgcccaagagttgcggcgtattggagacgagtttaac
gcttactatgcaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A0C4DH20_BCL2L11-19 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=249 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagcttccatgaggcaggctgaacctgcagatatgcgcc
cagagatatggatcgcccaagagttgcggcgtattggagacgagtttaacgcttactatgcaaggaggatgcctcttcca
cctgattaa
>gnl|bcl2dbcds|A0A0C4DH20_BCL2L11-15 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=258 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagcttccatgaggcaggctgaacctgcagatatgcgcc
cagagatatggatcgcccaagagttgcggcgtattggagacgagtttaacgcttactatgcaaggaggctggcaaaactc
ctggcatcctccacctga
>gnl|bcl2dbcds|A0A0C4DH20_BCL2L11-16 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=243 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggttagagaaatagaggaagttgtcgtg
tag
>gnl|bcl2dbcds|B4DQK3_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Homo sapiens GN=BBC3 (length=600 residues).
atggccccagggagcgccatggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacgg
cccgcgccccttcccgctcggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgccgccc
ccgccgcccccaccctgctgcccgctgcctacctctgcgcccccaccgccccacccgccgtcaccgccgccctggggggt
tcccgctggcctgggggtccccgcagccggccccgaggcccgcgcccggacggtcctcagccctcgctctcgctggcgga
gcagcacctggagtcgcccgtgcccagcgccccgggggctctggcgggcggtcccacccaggcggccccgggagtccgcg
gggaggaggaacagtgggcccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcacagtacgagcgg
cggagacaagaggagcagcagcggcaccgcccctcaccctggagggtcctgtacaatctcatcatgggactcctgccctt
acccaggggccacagagcccccgagatggagcccaattag
>gnl|bcl2dbcds|B4DZQ9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Homo sapiens GN=BAD (length=450 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacg
gaggacgacgaagggatgggggaggagcccagcccctttcggggccgttcgcgctcggcgccccccaacctctgggcagc
acagcgctatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagaagggacttcctcgcccgaaga
gcgcgggcacagcaacgcagatgcggcaaagccccaggcgcctgcgctaa
>gnl|bcl2dbcds|O00198_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Homo sapiens GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgcgcctgcagcgcgggtcgcctggggctgcgctc
gtccgccgcgcagctcaccgccgcccggctcaaggcgctaggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccttggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|Q13323_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Homo sapiens GN=BIK (length=483 residues).
atgtctgaagtaagacccctctccagagacatcttgatggagaccctcctgtatgagcagctcctggaacccccgaccat
ggaggttcttggcatgactgactctgaagaggacctggaccctatggaggacttcgattctttggaatgcatggagggca
gtgacgcattggccctgcggctggcctgcatcggggacgagatggacgtgagcctcagggccccgcgcctggcccagctc
tccgaggtggccatgcacagcctgggtctggctttcatctacgaccagactgaggacatcagggatgttcttagaagttt
catggacggtttcaccacacttaaggagaacataatgaggttctggagatccccgaaccccgggtcctgggtgtcctgcg
aacaggtgctgctggcgctgctgctgctgctggcgctgctgctgccgctgctcagcgggggcctgcacctgctgctcaag
tga
>gnl|bcl2dbcds|Q13794_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Homo sapiens GN=PMAIP1 (length=165 residues).
atgcctgggaagaaggcgcgcaagaacgctcaaccgagccccgcgcgggctccagcagagctggaagtcgagtgtgctac
tcaactcaggagatttggagacaaactgaacttccggcagaaacttctgaatctgatatccaaactcttctgctcaggaa
cctga
>gnl|bcl2dbcds|Q6JTU4_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=111 residues).
atgaggcaggctgaacctgcagatatgcgcccagagatatggatcgcccaagagttgcggcgtatcggagacgagtttaa
cgcttactatgcaaggaggttagagaaatag
>gnl|bcl2dbcds|Q92934_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Homo sapiens GN=BAD (length=474 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagaagggacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggcaaag
ctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgccccctcccagtgacctt
cgctccacatcccgaaactccacccgttcccactgccctgggcagccatcttgaatatgggcggaagtacttccctcagg
cctatgcaaaaagaggatccgtgctgtctcctttggagggagggctgacccagattcccttccggtgcgtgtga
>gnl|bcl2dbcds|Q92934_BAD-04 BCL2-associated agonist of cell death gene OS=[Eukaryota] Homo sapiens GN=BAD (length=492 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggagggagaacttcgtattctccttcttgggaatctgaggactctgaaaatcccagt
gcagggatgctcgcggaagcatcagcagggatgtccgccccagccgctgactcagaagcccaacacgcagagaatgtaaa
gctagaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacggaggacgacgaagggatggg
ggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaacctctgggcagcacagcgctatggccgcgagc
tccggaggatga
>gnl|bcl2dbcds|Q92934_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Homo sapiens GN=BAD (length=507 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacg
gaggacgacgaagggatgggggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaacctctgggcagc
acagcgctatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagaagggacttcctcgcccgaaga
gcgcgggcacagcaacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggc
aggggaagctccgccccctcccagtga
>gnl|bcl2dbcds|Q92934_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Homo sapiens GN=BAD (length=507 residues).
atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
aggggacgggccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacg
gaggacgacgaagggatgggggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaacctctgggcagc
acagcgctatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagaagggacttcctcgcccgaaga
gcgcgggcacagcaacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggc
aggggaagctccgccccctcccagtga
>gnl|bcl2dbcds|A0A0C4DH20_BCL2L11-25 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=330 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccatgaggcaggctgaacctgca
gatatgcgcccagagatatggatcgcccaagagttgcggcgtattggagacgagtttaacgcttactatgcaaggaggtt
agagaaatag
>gnl|bcl2dbcds|A0A0C4DH20_BCL2L11-12 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaaggtaatcctgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccacctgccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggctaact
gggactag
>gnl|bcl2dbcds|A0A0C4DH20_BCL2L11-24 BCL2-like 11 gene OS=[Eukaryota] Homo sapiens GN=BCL2L11 (length=297 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggatgactccgctggatcctccctcaga
attgcccttcatagggaagttcagtggccactcaagtggttagcaaaatcaagctaa
>gnl|bcl2dbcds|Q13794_PMAIP1-02 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Homo sapiens GN=PMAIP1 (length=411 residues).
atgcctgggaagaaggcgcgcaagaacgctcaaccgagccccgcgcgggctccagcaggaccggcgggtacggcgggtac
ggcgagggaccaagccggatttgcgattgggatgcagctgcgtttcaccaggggcaaaaagctcctttcctcctctcttt
cctcctcgccacttgcccttccccggggccacgaggaacaagtgcaagtagctggaagtcgagtgtgctactcaactcag
gagatttggagacaaactgaacttccggcagaaacttctgaatctgatatccaaactcttctgctcaggaacctgactgc
atcaaaaacttgcatgaggggactccttcaaaagagttttctcaggaggtgcacgtttcatcaatttgaagaaagactgc
attgtaattga
© 1998-2018