Dataset for CDS BBC3 of organism Homo sapiens

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|B4DQK3_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Homo sapiens GN=BBC3 (length=600 residues).
atggccccagggagcgccatggcccgcgcacgccaggagggcagctccccggagcccgtagagggcctggcccgcgacgg
cccgcgccccttcccgctcggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgccgccc
ccgccgcccccaccctgctgcccgctgcctacctctgcgcccccaccgccccacccgccgtcaccgccgccctggggggt
tcccgctggcctgggggtccccgcagccggccccgaggcccgcgcccggacggtcctcagccctcgctctcgctggcgga
gcagcacctggagtcgcccgtgcccagcgccccgggggctctggcgggcggtcccacccaggcggccccgggagtccgcg
gggaggaggaacagtgggcccgggagatcggggcccagctgcggcggatggcggacgacctcaacgcacagtacgagcgg
cggagacaagaggagcagcagcggcaccgcccctcaccctggagggtcctgtacaatctcatcatgggactcctgccctt
acccaggggccacagagcccccgagatggagcccaattag
© 1998-2018