Dataset for CDS BAD of organism Hippocampus comes

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3Q2Y0E4_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Hippocampus comes GN=BAD (length=522 residues).
atggccgcaaacttcagcatatccgacagcgagtccgagccctctgaggaggtagaagaaggggacgacggccaaggagc
cgctgaaaaagagcaggagcagtgcctccgccaaggcctccgcctcaccttgccggagctcccaatggaagcaatgtcgg
ggcggatccggctcaactcggagtcccacgctttggcagtgtcccgagaggaggagttccaggccagggtggacgaggag
gtcggcacacccaccgacggggcgccgttccgggggcgctccaagtcggctccccccgtgctatgggctgcgaaaaagta
cggacggcagctgcggcgcatgagcgacgagttcgatagcctgatggacaaaggggagttgaagttcaagagcgccggcg
gcacatccagggccatccaccactccaaaacctggtggagctacctcttcagccaccaggagacggagggcgagaacaac
aacaacaaccaccacgacaaccatgctaatcgtactgaatag
© 1998-2019