Dataset for CDS PMAIP1 of organism Gorilla gorilla gorilla

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A2I2YVQ5_PMAIP1-02 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=PMAIP1 (length=453 residues).
atgcctgggaagaaggcgcgcaagaacgctcaaccgagccccgcgcgggctccagcaggaccggcgggtacggcgaggga
ccaagccggctttgggattgagatgcagctgcgtttcaccaggggcaaaaagctcctttcctcctcgccacttgcccttc
cccggggccacgaggaacaagtgcaagtagctggaagtcgagtgtgctactcaactcaggagatttggagacaaactgaa
cttccggcagaaacttctgaatctgatatccaaactcttctgctcaggaacctgactgcatcaaaaacttgcatgagggg
actccttcaaaagagttttctcaggaggtgcacatttcatcagtttgaagaaagactgcattgtaattgggaggaatgtg
aaggtgcattcatgggtgcccttggaaacggaagatggaatacatcaaagtga
>gnl|bcl2dbcds|A0A2I2YVQ5_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=PMAIP1 (length=165 residues).
atgcctgggaagaaggcgcgcaagaacgctcaaccgagccccgcgcgggctccagcagagctggaagtcgagtgtgctac
tcaactcaggagatttggagacaaactgaacttccggcagaaacttctgaatctgatatccaaactcttctgctcaggaa
cctga
© 1998-2018