Dataset for CDS Unclassified of organism Gopherus agassizii

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A452H537_uncHRK-01 Putative Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Gopherus agassizii (length=264 residues).
atgtgcccctgcgcgctgcacggcgggccccccgccgcttgcccctgcagctccgcccggcgcggggcgcgcttctccgg
ggctcagctggtggcggcccgcctgaagctggtcggggatgagctgcaggagcggaccgcgtggcgcagggcgagcagca
ggcgagctgcggccgggagaagcctggccacctacctgtgtctgctgtgcgccgcctcgcaggtggccgcgctggtctgg
ctgatccgcaagaggagctggtag
© 1998-2019