Dataset for CDS classical BH3-containing proteins of organism Gopherus agassizii

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A452H3N6_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Gopherus agassizii GN=BMF (length=579 residues).
atggatccccccaactacctggaagacgactattccagcctggacgggctggacgatgacgtgtttcactctgactttgg
actcacaggtcagcctggtgagatgacccctcctggcattttcacacagaaccaatcctacagctgtctcctggggaggt
ttcaactgttccccctcacacactgctgtggtccaggtatcaggcatgctgagcagcaggacaaggcaacccaaacactc
agtccatcctcttctactcaggatgtcatgttgccatgtggagtcactgaagagccccagagactcttctatgggaatgc
tgggtaccgtttacatgtccccccagttggctttgcattgaatccgcacctccaagaggagcctcgggaaggtcagcggg
aagcacttgctgaggttcagattgcacggaagttacagtgcattgcagaccagttccacaggctccacatacagaggcat
cagcagaacagaaatcaagtgtggtggcagatccttctctttatacataacttggccttaaatgtggaggtgaacaggaa
ccacgtaggtcagaggtga
>gnl|bcl2dbcds|A0A452IFQ4_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Gopherus agassizii GN=BAD (length=426 residues).
atgtttcgcatccaggagttcccggacgaggtgttcccggggcgagggaaggaggcgcctgctccccccgagtcgcagcg
gggacacacgcccggctccaagcagccagacacccccacagctgaggtgcgaagccggatagggtcagacaccccatctc
tggagccagaagtgcaggatgagccaggtggggcattccgggcacgttcacgctcagcaccccccatcctttgggctgct
atgcgttatgggcgggagctgcgcaggatgagtgacgagtttgatgtggcgctgcaggtgctgccacgccccaagagtgc
aggcacgacatcccagctccaccgggggaacagctggaaagagaccctccaggcctggttggggcacagacccgcccgtg
atgccctccccaggagctccaagtga
>gnl|bcl2dbcds|A0A452J430_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Gopherus agassizii GN=PMAIP1 (length=165 residues).
atgccgggaaagaccctgcgcaagggtgcgcagcagaaccccgctctcccagcacaggaagctgtgacgcagtgctcttt
gcaactacgcaaaataggagatatatgcaacctgcagcagaagattcttaacgttattacaaaactgttctgcccaggaa
cgtga
© 1998-2019