Dataset for CDS BMF of organism Gopherus agassizii

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A452H3N6_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Gopherus agassizii GN=BMF (length=579 residues).
atggatccccccaactacctggaagacgactattccagcctggacgggctggacgatgacgtgtttcactctgactttgg
actcacaggtcagcctggtgagatgacccctcctggcattttcacacagaaccaatcctacagctgtctcctggggaggt
ttcaactgttccccctcacacactgctgtggtccaggtatcaggcatgctgagcagcaggacaaggcaacccaaacactc
agtccatcctcttctactcaggatgtcatgttgccatgtggagtcactgaagagccccagagactcttctatgggaatgc
tgggtaccgtttacatgtccccccagttggctttgcattgaatccgcacctccaagaggagcctcgggaaggtcagcggg
aagcacttgctgaggttcagattgcacggaagttacagtgcattgcagaccagttccacaggctccacatacagaggcat
cagcagaacagaaatcaagtgtggtggcagatccttctctttatacataacttggccttaaatgtggaggtgaacaggaa
ccacgtaggtcagaggtga
© 1998-2019