Dataset for CDS PMAIP1 of organism Gallus gallus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A1D5PAR2_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Gallus gallus GN=PMAIP1 (length=165 residues).
atgatgcccggcaggacgattcgcaaacctgcgccgcccgccgcgcctgcagagcgggacgcggtggctgagtgcgcgct
ggagctgcgcaggatcggagacaaggcggacctgcagcagaaagtcctgaacctcatcacgaaactgttctgccccaaaa
cgtga
© 1998-2018