Dataset for CDS classical BH3-containing proteins of organism Gallus gallus

[Download (right click)] [Alignment] [Repertoires]

7 sequence(s)

>gnl|bcl2dbcds|A0A1D5PAR2_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Gallus gallus GN=PMAIP1 (length=165 residues).
atgatgcccggcaggacgattcgcaaacctgcgccgcccgccgcgcctgcagagcgggacgcggtggctgagtgcgcgct
ggagctgcgcaggatcggagacaaggcggacctgcagcagaaagtcctgaacctcatcacgaaactgttctgccccaaaa
cgtga
>gnl|bcl2dbcds|A0A3Q2U844_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Gallus gallus GN=BCL2L11 (length=540 residues).
atggccaagcagccccccgaggcgaaggcgccccgcgaccgccgggccgggcggctgccgccgggagaggggccgggccc
ggccgtcccgctgcggcccggagcccccgccgcgctgcccggcgccgcccggcccgcctcgcccggcagccccggcccgt
tcgccatccgctcgccgctcttcttcttcgtgcggaggtccccgctgctgccgcgctcctccagcgggtacttctccttc
gaggccgagcgcagccccgcgcccatgagctgcgataaggccacgcagacccccagcccgccgtgccaggccgtcagcca
ctacctgagcgccatggcttccaggtggcgatctcactcgcttgcagaagaaatacaaccagaaatatggattgcacagg
agctgcggcgcatcggggatgaattcaatgcctcctattgtccaagaaggggtttcttggataaccgtgctggaaacccc
caggttgtcattctgcgcctcctgcattacatcatccgcctcatctggaggatgcagtga
>gnl|bcl2dbcds|A9XRG9_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Gallus gallus GN=BMF (length=603 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactatttcccctcacacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgggaa
tgctggttaccgcttacatgtccctccagttggctttgcattggatccaaatctccaagaagagcctcaggaaggtcagc
gggaggcacgtactgaggtgcagattgcacggaagttgcagtgcattgcagaccagttccaccggctccacatacagcgg
gtagggtgtttccacaggggaaggtggggtctttcttatctaagagtggtgctccagaagactggctccaggcttcggct
aagcaggctgttgcctaaggcagccgcaggctaccggcagtga
>gnl|bcl2dbcds|A9XRG9_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Gallus gallus GN=BMF (length=603 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactatttcccctcacacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgggaa
tgctggttaccgcttacatgtccctccagttggctttgcattggatccaaatctccaagaagagcctcaggaaggtcagc
gggaggcacgtactgaggtgcagattgcacggaagttgcagtgcattgcagaccagttccaccggctccacatacagcgg
gtagggtgtttccacaggggaaggtggggtctttcttatctaagagtggtgctccagaagactggctccaggcttcggct
aagcaggctgttgcctaaggcagccgcaggctaccggcagtga
>gnl|bcl2dbcds|A9XRG9_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Gallus gallus GN=BMF (length=582 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactatttcccctcacacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgggaa
tgctggttaccgcttacatgtccctccagttggctttgcattggatccaaatctccaagaagagcctcaggaaggtcagc
gggaggcacgtactgaggtgcagattgcacggaagttgcagtgcattgcagaccagttccaccggctccacatacagcgg
catcagcagaacagaaatcaagtgtggtggcagctttttctctttctacacaacttggccttaaacgtggaggcgaacag
gaaccgcactgggcagaggtga
>gnl|bcl2dbcds|A9XRG9_BMF-04 Bcl2 modifying factor gene OS=[Eukaryota] Gallus gallus GN=BMF (length=582 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactatttcccctcacacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgggaa
tgctggttaccgcttacatgtccctccagttggctttgcattggatccaaatctccaagaagagcctcaggaaggtcagc
gggaggcacgtactgaggtgcagattgcacggaagttgcagtgcattgcagaccagttccaccggctccacatacagcgg
catcagcagaacagaaatcaagtgtggtggcagctttttctctttctacacaacttggccttaaacgtggaggcgaacag
gaaccgcactgggcagaggtga
>gnl|bcl2dbcds|A9XRH0_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Gallus gallus GN=BMF (length=357 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcagggaatgctggttaccgcttacatgtccctccagttggctttgcattggatccaaatctccaagaagagc
ctcaggaaggtcagcgggaggcacgtactgaggtgcagattgcacggaagttgcagtgcattgcagaccagttccaccgg
ctccacatacagcggcatcagcagaacagaaatcaagtgtggtggcagctttttctctttctacacaacttggccttaaa
cgtggaggcgaacaggaaccgcactgggcagaggtga
© 1998-2019