Dataset for CDS BMF of organism Gallus gallus

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A3Q2UCA0_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Gallus gallus GN=BMF (length=603 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactatttcccctcacacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgggaa
tgctggttaccgcttacatgtccctccagttggctttgcattggatccaaatctccaagaagagcctcaggaaggtcagc
gggaggcacgtactgaggtgcagattgcacggaagttgcagtgcattgcagaccagttccaccggctccacatacagcgg
gtagggtgtttccacaggggaaggtggggtctttcttatctaagagtggtgctccagaagactggctccaggcttcggct
aagcaggctgttgcctaaggcagccgcaggctaccggcagtga
>gnl|bcl2dbcds|A0A3Q2UCA0_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Gallus gallus GN=BMF (length=603 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactatttcccctcacacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgggaa
tgctggttaccgcttacatgtccctccagttggctttgcattggatccaaatctccaagaagagcctcaggaaggtcagc
gggaggcacgtactgaggtgcagattgcacggaagttgcagtgcattgcagaccagttccaccggctccacatacagcgg
gtagggtgtttccacaggggaaggtggggtctttcttatctaagagtggtgctccagaagactggctccaggcttcggct
aagcaggctgttgcctaaggcagccgcaggctaccggcagtga
>gnl|bcl2dbcds|A0A3Q2UCA0_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Gallus gallus GN=BMF (length=582 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactatttcccctcacacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgggaa
tgctggttaccgcttacatgtccctccagttggctttgcattggatccaaatctccaagaagagcctcaggaaggtcagc
gggaggcacgtactgaggtgcagattgcacggaagttgcagtgcattgcagaccagttccaccggctccacatacagcgg
catcagcagaacagaaatcaagtgtggtggcagctttttctctttctacacaacttggccttaaacgtggaggcgaacag
gaaccgcactgggcagaggtga
>gnl|bcl2dbcds|A0A3Q2UCA0_BMF-04 Bcl2 modifying factor gene OS=[Eukaryota] Gallus gallus GN=BMF (length=582 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcaggtcagcctggtgagatgactgcaactggcattttcacacagaaccagtcctacagctgccttctgggga
ggtttcaactatttcccctcacacactgctgtggtcccggtgtcaggcatcctgagcagcaggacaaggcaactcaaaca
ctcagcccgtcctcttccagtcaggatgttatgttgccttgtggagtcactgaagagccccggagactcttctatgggaa
tgctggttaccgcttacatgtccctccagttggctttgcattggatccaaatctccaagaagagcctcaggaaggtcagc
gggaggcacgtactgaggtgcagattgcacggaagttgcagtgcattgcagaccagttccaccggctccacatacagcgg
catcagcagaacagaaatcaagtgtggtggcagctttttctctttctacacaacttggccttaaacgtggaggcgaacag
gaaccgcactgggcagaggtga
>gnl|bcl2dbcds|A9XRH0_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Gallus gallus GN=BMF (length=357 residues).
atggatcgccccagctacctggaagaggactattctagcctggatgggctggacgatgacgtgtttcactctgatgactt
tggacttgcagggaatgctggttaccgcttacatgtccctccagttggctttgcattggatccaaatctccaagaagagc
ctcaggaaggtcagcgggaggcacgtactgaggtgcagattgcacggaagttgcagtgcattgcagaccagttccaccgg
ctccacatacagcggcatcagcagaacagaaatcaagtgtggtggcagctttttctctttctacacaacttggccttaaa
cgtggaggcgaacaggaaccgcactgggcagaggtga
© 1998-2019