Dataset for CDS BAD of organism Fukomys damarensis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A091DDU4_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Fukomys damarensis GN=BAD (length=489 residues).
atgttccagatcccagagtttgagcccagtgagcaggaagactccagctccgaagagaggggcctgggccccagtcccat
aggggaccagctaggtcccagcccagcacgaggcttcctgggggacaccagtcaccagcagaggcagctgttcagcagca
gacaccatggaggcgctggggctatggagacccggagtcgccacagctcataccccacagggaccgaggaggaagagggg
atggaagaggagcccagcccattccggggccgctcgcgctcggcgcctcccaatctctgggctgcacagcgctacggcag
agagctccggaggatgagcgacgagttcgtggactccttcaagggtcttcctcgcccgaagagcgcaggcacagcgacga
agctctggcagagctccagctggacacgcgccatccagtcctggtgggatcggaacttgggaagaggaggctccgccccc
tctcagtga
© 1998-2018