Dataset for CDS BMF of organism Felis catus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|M3WRS0_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Felis catus GN=BMF (length=390 residues).
atggagccgcctcagtgtgtggaggagctagaggatgatgtgttccagccagaggatgtggagccggggacccagcctgg
gagcttgctgtctgctaacctgtttgcccagagccagctggactgccccctcagccatctgcagctcttccctctcaccc
actgctgtggtcctgggcttcgacccaccagccaggaagacaaggccacccagaccctcagtccggcctccccgagtcag
ggtgtcatgctgccttgtggggtgaccgaagaaccccagcgactcttttatgcaccagcaaaaccgccgtcgagtgtggt
ggcagattctcctcttcctacacaacctggctttgaatgcagaagagaacaggaatggggcaggtcccag
>gnl|bcl2dbcds|M3WRS0_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Felis catus GN=BMF (length=555 residues).
atggagccgcctcagtgtgtggaggagctagaggatgatgtgttccagccagaggatgtggagccggggacccagcctgg
gagcttgctgtctgctaacctgtttgcccagagccagctggactgccccctcagccatctgcagctcttccctctcaccc
actgctgtggtcctgggcttcgacccaccagccaggaagacaaggccacccagaccctcagtccggcctccccgagtcag
ggtgtcatgctgccttgtggggtgaccgaagaaccccagcgactcttttatggcaacgctggctaccggctccctctccc
tgccagtttccctgcaggcttgccccttggtgagcagccccctgaagggcattggcagcatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccatcggcttcatatgcagcaacaccagcaaaaccgccgtcgagtgtgg
tggcagattctcctcttcctacacaacctggctttgaatgcagaagagaacaggaatggggcaggtcccaggtga
© 1998-2018