Dataset for CDS classical BH3-containing proteins of organism Esox lucius

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|A0A3P8XIA2_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Esox lucius GN=BCL2L11 (length=399 residues).
agagagtcttcctgcgaagggaaccagcagtcacggggaggaataatgatgccgacgaatagtctgcttggtttccagtc
gaggtcgcctcttttcagaacaacatccacgtcctccagtggatatttttcgttcgactgcgactctattccaagctcgc
cactactaagaaataacaagtcgacacagactccgagcccatctagtcaagttattactcacgcaatgaggccgggggac
atgcggccggaaatactgatcggtcaggagcttcagcgcattggagatgagtttaacaacctgttcatacatggggtgag
tggttgcagtaaaatgcctgtgttgcatcaccttatttacaaaccatatcaaggaccgcactgtattaaattgagctga
>gnl|bcl2dbcds|A0A3P8XIA2_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Esox lucius GN=BCL2L11 (length=651 residues).
atgtttgattcgtccagaccacaaaatcggtccaatggcacgaccaccctaattgggagagggaaaatcggagagtcgca
tccctgtggcggagcaacctcgagttccaaactgtcagattacccccagtcctgcgaagggaaccagcagtcacggggag
gaataatgatgccgacgaatagtctgcttggtttccagtcgaggtcgcctcttttcagaacaacatccacgtcctccagt
ggatatttttcgttcgactgcgactctattccaagctcgccactactaagaaataacaagtcgacacagactccgagccc
atctagtcaagttattactcacgcaatgaggcgcttgtctaagccacaagacacctggcgaggttatgaagcgtggccca
ccccccaccacccctatagaccacggccaccaccaatagcgggggacatgcggccggaaatactgatcggtcaggagctt
cagcgcattggagatgagtttaacaacctgttcatacatgggcgtcttggggcaagaaatggtcaggttgcccaagcaaa
ccttcctcagatgcaccaagaacctgcctttctactgtggatgggcctcctgattggtcgactattacagatcatttggc
ggagaagataa
>gnl|bcl2dbcds|A0A3P8Y761_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Esox lucius GN=BAD (length=501 residues).
atggaaaatattttcactatatcagacaccgaatctgaatcctcagatgtagaagaaaccaaaaaggaatggattgccgg
acaggggaagactggaagccgattaggcctctcccttaacctaccaggcgagggccggataaggttaaactctgaatctc
aggtcttcgctacatctggtggggagaggagcggggagctccagggtttggggcaagggttgaactgtgtggccacagaa
ggactaccttttagggtccgctcccagtcagcccccccggccctctgggctgccaagagatatggacggcagctgcgacg
catgagtgacgagttcgatacgtggctggataaagggcaaatgaagcgggtgaagagtgcaggagcagccaaacagatga
caacatccccgagctggtgggccttcctgttcagccacaaggaaactgagacagaaaagacccccaaccttatcattact
gaaccaagatcttctgagtag
>gnl|bcl2dbcds|A0A3P8ZIE7_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Esox lucius GN=BMF (length=483 residues).
atggaggatgaggaggatgatgtgtttgagccagactcctactgctggcacacagcctccagggagataaagtacgagga
caggggcacccagactcccacaactgctctggcactgctcaatgacatgctaccctgcagattggaccaggatcccagac
cactgttctacggtaacgcaggctttcgattgcactttccggcccagtttgagtgcgttggagacccggggcctcagcag
cgtccccaggcggtgagaggggggatggagcacccccaacagctgccccagcagccagtagcccgttgcattggacagaa
gctccaactcattggtgaccagtttcatgaagaacatctgcaactgtatcacagaaaccaaaggaacctgaggcccctgt
ggtggcgcctggcctcggctctgctcactctgctgtgggagcaggaggccgtggctggaggcgggagagccgggtggagg
tga
>gnl|bcl2dbcds|A0A3P9A5G8_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Esox lucius GN=BAD (length=480 residues).
atggcttttaaaatggatcacactcaggattgtgtgggtgacattccagaaaacataaacgaaaaatatgatttggacca
cttaggaactacacattacccagaatttcagttctgtaatacctccactaatacaagcaatagaacactaccaggtgtac
gcgtccggctctactcggaatcccaggtgtgttcccaggttggcagacaggacaacacagagtttcaggttgcaatgact
cctacggaggagagtgggggcgatgcagcaccgttccggggccggtcacagtctgctccccctgcgctgtgggctgcaaa
aaaatatggctgccagctgaggaggatgagtgatgaatttgacacctggcttgacaaaggggagcccaagagaggaatta
tcccaggaagagcaaagcaggtctacagaggatggttctcgttcctctggagtccaaaggaagctgaaggcagggactga
>gnl|bcl2dbcds|A0A3P9A5G8_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Esox lucius GN=BAD (length=480 residues).
atggcttttaaaatggatcacactcaggattgtgtgggtgacattccagaaaacataaacgaaaaatatgatttggacca
cttaggaactacacattacccagaatttcagttctgtaatacctccactaatacaagcaatagaacactaccaggtgtac
gcgtccggctctactcggaatcccaggtgtgttcccaggttggcagacaggacaacacagagtttcaggttgcaatgact
cctacggaggagagtgggggcgatgcagcaccgttccggggccggtcacagtctgctccccctgcgctgtgggctgcaaa
aaaatatggctgccagctgaggaggatgagtgatgaatttgacacctggcttgacaaaggggagcccaagagaggaatta
tcccaggaagagcaaagcaggtctacagaggatggttctcgttcctctggagtccaaaggaagctgaaggcagggactga
© 1998-2019