Dataset for CDS BCL2L11 of organism Esox lucius

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A3P8XIA2_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Esox lucius GN=BCL2L11 (length=399 residues).
agagagtcttcctgcgaagggaaccagcagtcacggggaggaataatgatgccgacgaatagtctgcttggtttccagtc
gaggtcgcctcttttcagaacaacatccacgtcctccagtggatatttttcgttcgactgcgactctattccaagctcgc
cactactaagaaataacaagtcgacacagactccgagcccatctagtcaagttattactcacgcaatgaggccgggggac
atgcggccggaaatactgatcggtcaggagcttcagcgcattggagatgagtttaacaacctgttcatacatggggtgag
tggttgcagtaaaatgcctgtgttgcatcaccttatttacaaaccatatcaaggaccgcactgtattaaattgagctga
>gnl|bcl2dbcds|A0A3P8XIA2_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Esox lucius GN=BCL2L11 (length=651 residues).
atgtttgattcgtccagaccacaaaatcggtccaatggcacgaccaccctaattgggagagggaaaatcggagagtcgca
tccctgtggcggagcaacctcgagttccaaactgtcagattacccccagtcctgcgaagggaaccagcagtcacggggag
gaataatgatgccgacgaatagtctgcttggtttccagtcgaggtcgcctcttttcagaacaacatccacgtcctccagt
ggatatttttcgttcgactgcgactctattccaagctcgccactactaagaaataacaagtcgacacagactccgagccc
atctagtcaagttattactcacgcaatgaggcgcttgtctaagccacaagacacctggcgaggttatgaagcgtggccca
ccccccaccacccctatagaccacggccaccaccaatagcgggggacatgcggccggaaatactgatcggtcaggagctt
cagcgcattggagatgagtttaacaacctgttcatacatgggcgtcttggggcaagaaatggtcaggttgcccaagcaaa
ccttcctcagatgcaccaagaacctgcctttctactgtggatgggcctcctgattggtcgactattacagatcatttggc
ggagaagataa
© 1998-2019