Dataset for CDS classical BH3-containing proteins of organism Erinaceus europaeus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A1S3WU31_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Erinaceus europaeus GN=BMF (length=555 residues).
atggagctcccccagtgtgtggatgagctagaggatgacgtgttccagcctgaggatggggagccagggaccacaccagg
gagcttgctctcctctgacctgttcgcccagagcccgatggactgctccctcagccggctgcagctcttcccactcacgc
actgctgcggccctgggcttcgacctgccagccaggaggacaaggccacccagaccctcagcccagcctccccaagccag
ggtgtcatgctaccctgtggggtgacagaggaaccccagcgactcttctacggcaatgcaggctaccggctgccgctccc
caacagcttccctgcaggctctccctttgcagagcagcgccgtgaagggcagtggcagcagcgagtagaagtgcagatcg
ctcgcaagcttcagtgcattgcagaccagttccaccacctgcacatgcagcaacaccagcagaaccgaaatccagtgtgg
tggccgttcctgctcttcctacacaacctggctttgaatgagggtgagaatagaaacagggaagcgcccaggtga
© 1998-2018