Dataset for CDS classical BH3-containing proteins of organism Equus caballus

[Download (right click)] [Alignment] [Repertoires]

9 sequence(s)

>gnl|bcl2dbcds|A0A3Q2GRS5_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Equus caballus GN=BCL2L11 (length=702 residues).
atgttcccggcggcggcggccggggcagcgcgggccagaggcgcggcgcgcggagccctcggctgccctgcggagcgcgg
cggcggcgggcgggcggcaagcggcaggctctgcgctgtcctggcgcctctgagcgcgagtcccgggctttgtctccccc
gctgcctaagtggcgacaatcagggggctccgggtcggcgaaaggcgcgggctggacgccgcggggcccgggcccggacg
cgacgctcggaagggaaggggcggataaaaaaagaccaaatggccaaacaaccttccgatgtaagttctgagtgtgacag
agaaggcggacaattgcagcctgcggagaggcctcctcagctcaggcctggggcccccacctctctacagatagagcagc
aagacaggagcccggcacccatgagttgtgacaaatcaacacaaacgccaagtcctccttgccaagccttcaaccactat
ctcagtgcaatggcttccatgaggcagtcgcaggcggtccctgcagacatgcgcccggaggtatggatcgctcaagagct
gcggagaattggagacgaatttaatgcctcttacccacggagggtcgttttgaatcatcaccaagcagctgaagcccacc
cccaaatgatcatcttgcgactgttacgttacatcatccgcctggtacggagactgcagtga
>gnl|bcl2dbcds|A0A3Q2GWE8_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Equus caballus GN=BBC3 (length=582 residues).
atggcccgagcacgccaggagggcagctccccggagccggtagagggcctggcccgcgacggcccgcgccccttcccgct
cagccgcctggtgccctcggccgtgtcctgcggcctctgcgagcccggcctgcccgccgcgcccgccgcgcccgccctgc
tgcccgctgcctacctctgcgcccccgccgccccgcccgccgtcaccgccgccctggggggcccccgctggcctgggggc
ccccgcagccgtccccgagccccgcgccccgacggtccacagccctcactcttgccggccgagcagcacctggagtcgcc
ggtgcccagcgccccgggggccctggagggcggccccacccaggcagccccgggagtccggggggaggaggagcagtggg
cccgggagatcggggcccagctgcggcggatggcggacgacctgaacgcgctgtacgagcggcggagacaagaggagcag
cagcgacaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctgcccctacccaggggccgagcggc
cccggagatggagcccaactag
>gnl|bcl2dbcds|A0A3Q2I0H2_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Equus caballus GN=PMAIP1 (length=165 residues).
atgcctacaaggaaggcgcgtaagtctgggcagccgagccccacgcgagccccggcagagcttgaggctgagtgtgccat
tcaaattaggagaattggagacaaactgaatttccggcagaaacttctgaatctcatagccaaactcttccgctcaggaa
cctga
>gnl|bcl2dbcds|A0A3Q2IBL3_HRK-01 Harakiri, BCL2 interacting protein gene OS=[Eukaryota] Equus caballus GN=HRK (length=276 residues).
atgtgcccgtgccccctgcaccgcggccgcggccccccggccgtgtgtgcctgcagcgcgggccgcctgggtctgcgctc
gtcagccgcgcagctcacggccgcccggctcaaggcgctcggcgacgagctgcaccagcgcaccatgtggcggcgccgcg
cgcggagccggagggcgccggcgcccggcgcgctccccacctactggccctggctgtgcgcggccgcgcaggtggcggcg
ctggcggcctggctgctcggcaggcggaacttgtag
>gnl|bcl2dbcds|A0A3Q2LHE3_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Equus caballus GN=BIK (length=546 residues).
atgtctcaagtaggacccgtctccagggacctctttctggacgccttcctgcacgagcgcagcccggaagccctggaggt
tcctggcatgaccgagctcacagagtcctcccccgacagtgacaaccgtgactctgtggccatgcggctggccttcatcg
gggacgagatggaagtgagatggatgctgccccacatcgctgagctgcctggggtggccgtgtacagcttggccttcacc
tacaaccagacaggcctgaggggtgtttttagaagtttcatggatggtctcactaacctcagggagaacataaggttctg
gagcttcctgacccgcagggacagggtaagcctgagatttcatgaccttgactcaccttcctgcatgtgtagccctctgg
agccgtggagcagctgccccgtagggcacagcctcgctggttgccacagtccccaccaatccctattgtcttcttttgcc
tgcttcacccattcctcctcctgcctgttccctgggcctttgggtttgagatggctggcttactga
>gnl|bcl2dbcds|A0A3Q2LHE3_BIK-02 BCL2-interacting killer gene OS=[Eukaryota] Equus caballus GN=BIK (length=681 residues).
atgagaaagcggcggcgtcacgcagctgctaagcggcagacctgggattcgaactcaggccctctggtttcagagccgcg
ttcttcatcatcgtattctgtacctaaggctgtttggtccagtgtgggagaagaaatgtctcaagtaggacccgtctcca
gggacctctttctggacgccttcctgcacgagcgcagcccggaagccctggaggttcctggcatgaccgagctcacagag
tcctcccccgacagtgacaaccgtgactctgtggccatgcggctggccttcatcggggacgagatggaagtgagatggat
gctgccccacatcgctgagctgcctggggtggccgtgtacagcttggccttcacctacaaccagacaggcctgaggggtg
tttttagaagtttcatggatggtctcactaacctcagggagaacataaggttctggagcttcctgacccgcagggacagg
gtaagcctgagatttcatgaccttgactcaccttcctgcatgtgtagccctctggagccgtggagcagctgccccgtagg
gcacagcctcgctggttgccacagtccccaccaatccctattgtcttcttttgcctgcttcacccattcctcctcctgcc
tgttccctgggcctttgggtttgagatggctggcttactga
>gnl|bcl2dbcds|F6TJI0_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Equus caballus GN=BMF (length=684 residues).
atggagccgcctcagtgtgtagaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcccag
gagcttgctctctgctgacctgtttgccccgagccagctggactgccccctcagccatctgcggctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcagtccagcctccccaagccag
ggtgtcatgctgccttgtggggtgaccgaggaaccccagcgactcttttatggcaatgctggctaccggctccctctccc
tgccagtttccctgcaggcttgccccttggtgagcagccccctgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaaacttcagtgcattgcagaccagttccatcggcttcatatgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagaccctgctctttctccacaacctcgctttgaacggagacgagaacaggaacggggcaggtcccagcttccagcc
aggccaggagggtgtgctctggaagtcagcaggattgcagctgcctctgtccgaacttcttcccttctctccctgctgtg
gcactaatggagagaatttaaagcagccagtctggctgctctga
>gnl|bcl2dbcds|F6TJI0_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Equus caballus GN=BMF (length=675 residues).
atggagccgcctcagtgtgtagaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcccag
gagcttgctctctgctgacctgtttgccccgagccagctggactgccccctcagccatctgcggctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcagtccagcctccccaagccag
ggtgtcatgctgccttgtggggtgaccgaggaaccccagcgactcttttatggcaatgctggctaccggctccctctccc
tgccagtttccctgcaggcttgccccttggtgagcagccccctgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaaacttcagtgcattgcagaccagttccatcggcttcatatgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagaccctgctctttctccacaacctcgctttgaacggagacgagaacaggaacggggcaggtcccaggtgtggtaa
aaatgtgaggggacccgttagggaattggagacttctgacttgtttctcagctgccatcctgagttacccccagctcccg
gcttttgtcaggacttcgtgctctcttggagttga
>gnl|bcl2dbcds|F7DN67_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Equus caballus GN=BAD (length=642 residues).
atggggaccccagagaacccctcccctgctcccacacacgcccagggcacgaggaagtcgacagccgagcatccggagac
gaggaggggacccaggaaggaaggcggggggcggagagccggtccggcggcggggagcatgttccagatcccagagtttg
agcagagtgagccagaagactccagccctgcagataggggcctgggccccagccctacgggggactggccctcagacccg
gtcaggcaccagcggacagccccaggcctcctgggggaagctggtcaccagcaggggcagccggccagcagcagccacca
tggaggcgctggggcggtggagacccggagtcgccatagctcgtaccccgaggggaccgaggatgaagggatggaagggg
aggagcccggccccttccggggccgctcgcgctcggcgccccccaacctctgggctgcacgacgctacggccgcgagctc
cggaggatgagcgacgagttccaggtctccttccaggcacttcctcgcccgaagagcgcgggcacagcgacgcagatgcg
gcaaagccccagctggacgcgcgccatccagtcctggtgggatcggaacttggggagaggaggctccgccccctcccagt
ga
© 1998-2019