Dataset for CDS classical BH3-containing proteins of organism Equus caballus

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|F6RS78_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Equus caballus GN=BIK (length=240 residues).
atgtctcaagtaggacccgtctccagggacctctttctggacgccttcctgcacgagcgcagcccggaagccctggaggt
tcctggcatgaccgagctcacagattcccagagcccctccccacaaggagagggtgacaaccgtgactctgtggccatgc
ggctggccttcatcggggacgagatggaagtgagatggatgctgccccacatcgctgagctgcctggggtggccgtgtac
>gnl|bcl2dbcds|F6TJI0_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Equus caballus GN=BMF (length=567 residues).
ctaacaggggacatggagccgcctcagtgtgtagaggagctggaggatgatgtgttccagccagaggatggggagccggg
gacccagcccaggagcttgctctctgctgacctgtttgccccgagccagctggactgccccctcagccatctgcggctct
tccctctcacccactgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcagtccagcc
tccccaagccagggtgtcatgctgccttgtggggtgaccgaggaaccccagcgactcttttatggcaatgctggctaccg
gctccctctccctgccagtttccctgcaggcttgccccttggtgagcagccccctgaagggcagtggcaacatcgagcag
aggtacagattgcccgaaaacttcagtgcattgcagaccagttccatcggcttcatatgcagcaacaccagcagaaccga
aatcgcgtgtggtggcagaccctgctctttctccacaacctcgctttgaacggagacgagaacaggaacggggcaggtcc
caggtga
>gnl|bcl2dbcds|F7A7D2_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Equus caballus GN=BCL2L11 (length=591 residues).
atggccaaacaaccttccgatgtaagttctgagtgtgacagagaaggcggacaattgcagcctgcggagaggcctcctca
gctcaggcctggggcccccacctctctacagatagagcagcaaggtaatcccggaggcgaaggggaccgctgcccccaag
gcagccctctgggcccgctggccccaccggccagccctggcccttttgctaccagatccccgtttttcatctttgtgaga
agatcttccctgctgtctcgctcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaacgccaagtcctccttgccaagccttcaaccactatctcagtgcaatggcttccatgaggcagtcgc
aggcggtccctgcagacatgcgcccggaggtatggatcgctcaagagctgcggagaattggagacgaatttaatgcctct
tacccacggagggtcgttttgaatcatcaccaagcagctgaagcccacccccaaatgatcatcttgcgactgttacgtta
catcatccgcctggtacggagactgcagtga
>gnl|bcl2dbcds|F7CQN5_BBC3-01 BCL2 binding component 3 gene OS=[Eukaryota] Equus caballus GN=BBC3 (length=348 residues).
gctggacaaagttctcgccctcgcggccctgcaccgcgaggtccacagccctcactcttgccggccgagcagcacctgga
gtcgccggtgcccagcgccccgggggccctggagggcggccccacccaggcagccccgggagtccggggggaggaggagc
agtgggcccgggagatcggggcccagctgcggcggatggcggacgacctgaacgcgctgtacgagcggcggagacaagag
gagcagcagcgacaccgcccctcgccctggagggtcctgtacaatctcatcatgggactcctgcccctacccaggggccg
agcggccccggagatggagcccaactag
>gnl|bcl2dbcds|F7DN67_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Equus caballus GN=BAD (length=507 residues).
atgttccagatcccagagtttgagcagagtgagccagaagactccagccctgcagataggggcctgggccccagccctac
gggggactggccctcagacccggtcaggcaccagcggacagccccaggcctcctgggggaagctggtcaccagcaggggc
agccggccagcagcagccaccatggaggcgctggggcggtggagacccggagtcgccatagctcgtaccccgaggggacc
gaggatgaagggatggaaggggaggagcccggccccttccggggccgctcgcgctcggcgccccccaacctctgggctgc
acgacgctacggccgcgagctccggaggatgagcgacgagttccaggtctccttccagaaggcacttcctcgcccgaaga
gcgcgggcacagcgacgcagatgcggcaaagccccagctggacgcgcgccatccagtcctggtgggatcggaacttgggg
agaggaggctccgccccctcccagtga
© 1998-2018