Dataset for CDS classical BH3-containing proteins of organism Equus caballus

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|F6RS78_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Equus caballus GN=BIK (length=546 residues).
atgtctcaagtaggacccgtctccagggacctctttctggacgccttcctgcacgagcgcagcccggaagccctggaggt
tcctggcatgaccgagctcacagagtcctcccccgacagtgacaaccgtgactctgtggccatgcggctggccttcatcg
gggacgagatggaagtgagatggatgctgccccacatcgctgagctgcctggggtggccgtgtacagcttggccttcacc
tacaaccagacaggcctgaggggtgtttttagaagtttcatggatggtctcactaacctcagggagaacataaggttctg
gagcttcctgacccgcagggacagggtaagcctgagatttcatgaccttgactcaccttcctgcatgtgtagccctctgg
agccgtggagcagctgccccgtagggcacagcctcgctggttgccacagtccccaccaatccctattgtcttcttttgcc
tgcttcacccattcctcctcctgcctgttccctgggcctttgggtttgagatggctggcttactga
>gnl|bcl2dbcds|F6RS78_BIK-02 BCL2-interacting killer gene OS=[Eukaryota] Equus caballus GN=BIK (length=681 residues).
atgagaaagcggcggcgtcacgcagctgctaagcggcagacctgggattcgaactcaggccctctggtttcagagccgcg
ttcttcatcatcgtattctgtacctaaggctgtttggtccagtgtgggagaagaaatgtctcaagtaggacccgtctcca
gggacctctttctggacgccttcctgcacgagcgcagcccggaagccctggaggttcctggcatgaccgagctcacagag
tcctcccccgacagtgacaaccgtgactctgtggccatgcggctggccttcatcggggacgagatggaagtgagatggat
gctgccccacatcgctgagctgcctggggtggccgtgtacagcttggccttcacctacaaccagacaggcctgaggggtg
tttttagaagtttcatggatggtctcactaacctcagggagaacataaggttctggagcttcctgacccgcagggacagg
gtaagcctgagatttcatgaccttgactcaccttcctgcatgtgtagccctctggagccgtggagcagctgccccgtagg
gcacagcctcgctggttgccacagtccccaccaatccctattgtcttcttttgcctgcttcacccattcctcctcctgcc
tgttccctgggcctttgggtttgagatggctggcttactga
>gnl|bcl2dbcds|F6TJI0_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Equus caballus GN=BMF (length=675 residues).
atggagccgcctcagtgtgtagaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcccag
gagcttgctctctgctgacctgtttgccccgagccagctggactgccccctcagccatctgcggctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcagtccagcctccccaagccag
ggtgtcatgctgccttgtggggtgaccgaggaaccccagcgactcttttatggcaatgctggctaccggctccctctccc
tgccagtttccctgcaggcttgccccttggtgagcagccccctgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaaacttcagtgcattgcagaccagttccatcggcttcatatgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagaccctgctctttctccacaacctcgctttgaacggagacgagaacaggaacggggcaggtcccaggtgtggtaa
aaatgtgaggggacccgttagggaattggagacttctgacttgtttctcagctgccatcctgagttacccccagctcccg
gcttttgtcaggacttcgtgctctcttggagttga
>gnl|bcl2dbcds|F6TJI0_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Equus caballus GN=BMF (length=684 residues).
atggagccgcctcagtgtgtagaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcccag
gagcttgctctctgctgacctgtttgccccgagccagctggactgccccctcagccatctgcggctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcagtccagcctccccaagccag
ggtgtcatgctgccttgtggggtgaccgaggaaccccagcgactcttttatggcaatgctggctaccggctccctctccc
tgccagtttccctgcaggcttgccccttggtgagcagccccctgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaaacttcagtgcattgcagaccagttccatcggcttcatatgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagaccctgctctttctccacaacctcgctttgaacggagacgagaacaggaacggggcaggtcccagcttccagcc
aggccaggagggtgtgctctggaagtcagcaggattgcagctgcctctgtccgaacttcttcccttctctccctgctgtg
gcactaatggagagaatttaaagcagccagtctggctgctctga
>gnl|bcl2dbcds|F7DN67_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Equus caballus GN=BAD (length=642 residues).
atggggaccccagagaacccctcccctgctcccacacacgcccagggcacgaggaagtcgacagccgagcatccggagac
gaggaggggacccaggaaggaaggcggggggcggagagccggtccggcggcggggagcatgttccagatcccagagtttg
agcagagtgagccagaagactccagccctgcagataggggcctgggccccagccctacgggggactggccctcagacccg
gtcaggcaccagcggacagccccaggcctcctgggggaagctggtcaccagcaggggcagccggccagcagcagccacca
tggaggcgctggggcggtggagacccggagtcgccatagctcgtaccccgaggggaccgaggatgaagggatggaagggg
aggagcccggccccttccggggccgctcgcgctcggcgccccccaacctctgggctgcacgacgctacggccgcgagctc
cggaggatgagcgacgagttccaggtctccttccaggcacttcctcgcccgaagagcgcgggcacagcgacgcagatgcg
gcaaagccccagctggacgcgcgccatccagtcctggtgggatcggaacttggggagaggaggctccgccccctcccagt
ga
© 1998-2019