Dataset for CDS BMF of organism Equus caballus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|F6TJI0_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Equus caballus GN=BMF (length=675 residues).
atggagccgcctcagtgtgtagaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcccag
gagcttgctctctgctgacctgtttgccccgagccagctggactgccccctcagccatctgcggctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcagtccagcctccccaagccag
ggtgtcatgctgccttgtggggtgaccgaggaaccccagcgactcttttatggcaatgctggctaccggctccctctccc
tgccagtttccctgcaggcttgccccttggtgagcagccccctgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaaacttcagtgcattgcagaccagttccatcggcttcatatgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagaccctgctctttctccacaacctcgctttgaacggagacgagaacaggaacggggcaggtcccaggtgtggtaa
aaatgtgaggggacccgttagggaattggagacttctgacttgtttctcagctgccatcctgagttacccccagctcccg
gcttttgtcaggacttcgtgctctcttggagttga
>gnl|bcl2dbcds|F6TJI0_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Equus caballus GN=BMF (length=684 residues).
atggagccgcctcagtgtgtagaggagctggaggatgatgtgttccagccagaggatggggagccggggacccagcccag
gagcttgctctctgctgacctgtttgccccgagccagctggactgccccctcagccatctgcggctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcagtccagcctccccaagccag
ggtgtcatgctgccttgtggggtgaccgaggaaccccagcgactcttttatggcaatgctggctaccggctccctctccc
tgccagtttccctgcaggcttgccccttggtgagcagccccctgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaaacttcagtgcattgcagaccagttccatcggcttcatatgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagaccctgctctttctccacaacctcgctttgaacggagacgagaacaggaacggggcaggtcccagcttccagcc
aggccaggagggtgtgctctggaagtcagcaggattgcagctgcctctgtccgaacttcttcccttctctccctgctgtg
gcactaatggagagaatttaaagcagccagtctggctgctctga
© 1998-2019