Dataset for CDS BMF of organism Equus caballus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|F6TJI0_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Equus caballus GN=BMF (length=567 residues).
ctaacaggggacatggagccgcctcagtgtgtagaggagctggaggatgatgtgttccagccagaggatggggagccggg
gacccagcccaggagcttgctctctgctgacctgtttgccccgagccagctggactgccccctcagccatctgcggctct
tccctctcacccactgctgtggccctggccttcgacccaccagccaggaagacaaggccacccagaccctcagtccagcc
tccccaagccagggtgtcatgctgccttgtggggtgaccgaggaaccccagcgactcttttatggcaatgctggctaccg
gctccctctccctgccagtttccctgcaggcttgccccttggtgagcagccccctgaagggcagtggcaacatcgagcag
aggtacagattgcccgaaaacttcagtgcattgcagaccagttccatcggcttcatatgcagcaacaccagcagaaccga
aatcgcgtgtggtggcagaccctgctctttctccacaacctcgctttgaacggagacgagaacaggaacggggcaggtcc
caggtga
© 1998-2018