Dataset for CDS BIK of organism Equus caballus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|F6RS78_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Equus caballus GN=BIK (length=240 residues).
atgtctcaagtaggacccgtctccagggacctctttctggacgccttcctgcacgagcgcagcccggaagccctggaggt
tcctggcatgaccgagctcacagattcccagagcccctccccacaaggagagggtgacaaccgtgactctgtggccatgc
ggctggccttcatcggggacgagatggaagtgagatggatgctgccccacatcgctgagctgcctggggtggccgtgtac
© 1998-2018