Dataset for CDS classical BH3-containing proteins of organism Dipodomys ordii

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|A0A1S3EQA2_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Dipodomys ordii GN=BMF (length=531 residues).
atggagccgcctcagtgtgtggaggagctggaggacgatgtgttccaagcagaagacggggagccagggacccagccggg
gagcctgctctctgctaccctgtttgcccagagtcagctggactgccccctcagccggcttcagctcttccctctcaccc
actgctgtggcccaggacttcgacccaccagccaggaagacaaggccactcagaccctcagcccggcctcccccagccag
ggtgtcatgctgccctgtggggtgactgaagagccccagcgactcttttatggcagtgctggctaccggctcccactccc
tgccggtttccccgcagcccagcagccccccgaaggccaccgcgtggaggtgcagatcgcccggaagctgcagtgcatcg
ccgatcagttccatcggcttcatacgcagcggcaccagcagcaccgggaccgagcttgggggcaggtcctcctcttcctg
cacaacctggccttgaaccgagaaaacagggaccgggcgggccccaggtga
>gnl|bcl2dbcds|A0A1S3EQA2_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Dipodomys ordii GN=BMF (length=546 residues).
attgtcccaggggagatggagccgcctcagtgtgtggaggagctggaggacgatgtgttccaagcagaagacggggagcc
agggacccagccggggagcctgctctctgctaccctgtttgcccagagtcagctggactgccccctcagccggcttcagc
tcttccctctcacccactgctgtggcccaggacttcgacccaccagccaggaagacaaggccactcagaccctcagcccg
gcctcccccagccagggtgtcatgctgccctgtggggtgactgaagagccccagcgactcttttatggcagtgctggcta
ccggctcccactccctgccggtttccccgcagcccagcagccccccgaaggccaccgcgtggaggtgcagatcgcccgga
agctgcagtgcatcgccgatcagttccatcggcttcatacgcagcggcaccagcagcaccgggaccgagcttgggggcag
gtcctcctcttcctgcacaacctggccttgaaccgagaaaacagggaccgggcgggccccaggtga
>gnl|bcl2dbcds|A0A1S3FHA8_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Dipodomys ordii GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtggacagttgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagagcagcaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccctgccaggccttcaaccattatctcagcgcaatggcttccatgaggcagtctcaggaagag
cctgcagatttgcgcccagagatatggatcgcccaggaattgcggcgtattggagacgagtttgatgcctattatccaag
gagggtatttttgaataattaccaagcagccgaagaccaaccccaaatggttatcttacggctgttacgttacatcattc
gcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A1S3FHA8_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Dipodomys ordii GN=BCL2L11 (length=603 residues).
atggcaaagcaaccttccgatgtaagttctgagtgtgaccgagaaggtggacagttgcagcctgctgagaggcctcccca
gctcaggcctggggcccctacctccctacagacagagcagcaaggtaatcccgaaggcagtcccgaaggcgaaggggacc
gctgcccccaaggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttgtgagaagatcttccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccctgccaggccttcaaccattatctcagcgcaatggcttcca
tgaggcagtctcaggaagagcctgcagatttgcgcccagagatatggatcgcccaggaattgcggcgtattggagacgag
tttgatgcctattatccaaggagggtatttttgaataattaccaagcagccgaagaccaaccccaaatggttatcttacg
gctgttacgttacatcattcgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A1S3FL84_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Dipodomys ordii GN=BAD (length=465 residues).
atgttccagatcccagagtttgagccaagtgagcaggaagactccagctcagcagacaggggcctgggccccagcctctg
cccggccccaggcctcctgggggaccacagcccccagcagggactgccaaccagccgcagccaccatggaggtgctgggg
ctgtggagaccaggagtcgccatagttcataccctgcggggatggaggaggatgaagggctggaagaggagcctagcccc
tttcggggtcgctcacgctcggctcccccaaatctctgggctgccaggcgctatggccgcgagctccggaggatgagtga
cgagtttgacggctcctttaagggacttcctcgccccaaaagcgcgggcaccgccacgcagatgaggcagagttccagct
ggacgcgcatcttccagtcttggtgggaccggaacttgggccgaggctccgccccttctcagtga
>gnl|bcl2dbcds|A0A1S3FUQ7_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Dipodomys ordii GN=BIK (length=450 residues).
atgtcggaggccgggtctgtcaccagggacctcttcatcaagaccctcctgtaccagcagatgcccggacctcggccggc
agccgggcttttcccgatcaccgagcctatgggggaagaggtctgggaccccatggactgtctggagggcagtaaccagg
tggccctgtggctggtgtgcatcggcgacgaaatggaccagcgcctccgaagtcctcgcctggcccagctgccggggatg
gccatacacagcctggctctgacctacagccagatgggtgtctggggagtgctccgacgcctcatccgtggggtcgccca
cctgagggcgcacatcagggcctggagaccccccatcccccgcctccaggtgtcccctggccaggtccgcaggcagatgc
tgcccgcagtgctgctgctctgcggagccctgcagctgctgctccagtga
© 1998-2018