Dataset for CDS BMF of organism Dipodomys ordii

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A1S3EQA2_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Dipodomys ordii GN=BMF (length=546 residues).
attgtcccaggggagatggagccgcctcagtgtgtggaggagctggaggacgatgtgttccaagcagaagacggggagcc
agggacccagccggggagcctgctctctgctaccctgtttgcccagagtcagctggactgccccctcagccggcttcagc
tcttccctctcacccactgctgtggcccaggacttcgacccaccagccaggaagacaaggccactcagaccctcagcccg
gcctcccccagccagggtgtcatgctgccctgtggggtgactgaagagccccagcgactcttttatggcagtgctggcta
ccggctcccactccctgccggtttccccgcagcccagcagccccccgaaggccaccgcgtggaggtgcagatcgcccgga
agctgcagtgcatcgccgatcagttccatcggcttcatacgcagcggcaccagcagcaccgggaccgagcttgggggcag
gtcctcctcttcctgcacaacctggccttgaaccgagaaaacagggaccgggcgggccccaggtga
>gnl|bcl2dbcds|A0A1S3EQA2_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Dipodomys ordii GN=BMF (length=531 residues).
atggagccgcctcagtgtgtggaggagctggaggacgatgtgttccaagcagaagacggggagccagggacccagccggg
gagcctgctctctgctaccctgtttgcccagagtcagctggactgccccctcagccggcttcagctcttccctctcaccc
actgctgtggcccaggacttcgacccaccagccaggaagacaaggccactcagaccctcagcccggcctcccccagccag
ggtgtcatgctgccctgtggggtgactgaagagccccagcgactcttttatggcagtgctggctaccggctcccactccc
tgccggtttccccgcagcccagcagccccccgaaggccaccgcgtggaggtgcagatcgcccggaagctgcagtgcatcg
ccgatcagttccatcggcttcatacgcagcggcaccagcagcaccgggaccgagcttgggggcaggtcctcctcttcctg
cacaacctggccttgaaccgagaaaacagggaccgggcgggccccaggtga
© 1998-2018