Dataset for CDS BIK of organism Dipodomys ordii

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A1S3FUQ7_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Dipodomys ordii GN=BIK (length=450 residues).
atgtcggaggccgggtctgtcaccagggacctcttcatcaagaccctcctgtaccagcagatgcccggacctcggccggc
agccgggcttttcccgatcaccgagcctatgggggaagaggtctgggaccccatggactgtctggagggcagtaaccagg
tggccctgtggctggtgtgcatcggcgacgaaatggaccagcgcctccgaagtcctcgcctggcccagctgccggggatg
gccatacacagcctggctctgacctacagccagatgggtgtctggggagtgctccgacgcctcatccgtggggtcgccca
cctgagggcgcacatcagggcctggagaccccccatcccccgcctccaggtgtcccctggccaggtccgcaggcagatgc
tgcccgcagtgctgctgctctgcggagccctgcagctgctgctccagtga
© 1998-2018