Dataset for CDS Unclassified of organism Danio rerio

[Download (right click)]

3 sequence(s)

>gnl|bcl2dbcds|A0A2R8RYV1_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Danio rerio (length=681 residues).
atggatgatgaggaggatgaacagcttcctcgctgctgtgaaacgccgctaagaaacaagcgctccgagaagagagacgc
ccacggtggagacgtgggacaaacagctcacagacacgcatccacacagactgctggctctgtcctcaattcagcgagag
acgcagatatggcaccattccagggctcacagagagaagcatcatctctttgcagagttgtgggtgctaggactgcattc
agggctccctgtggaactgggggccttgtgtcacttactatgggccccggagcccggggtgggccaagagcactttttca
tggaaacgctggatttcgtgcacacttccctgcgctgttcgaacccgccctggatggcttacaaaacgccgaacagagag
agcaggacgaaggcagaccagaagaaaaagaagaggatcgcgacgcagggattagcgtggaggtccagattggacgtaaa
ttacgtgaaatgggggatcagtttcagcaagagcatcttcagctggtaagagtcattcacatcagactgattcttttctt
caaggccgctgggtttcagatgtgtgtggtcagaaactggtggtttcagtcacgatgcaaaatgacatcactgtctgcta
tttcagtgctgaatatgcaaattcccaagagggagcaatga
>gnl|bcl2dbcds|Q0GKC4_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Danio rerio (length=627 residues).
atggatgatgaggaggatgaacagcttcctcgctgctgtgaaacgccgctaagaaacaagcgctcagagaagagagacgc
ccacggtggagacgtgggacaaacagctcacagacacgcatccacacagactgctggctctgtcctcaattcagcgagag
acgcagatatggcaccattccagggctcacagagagaagcatcatctctttgcagagttgtgggtgctaggactgcattc
agggctccctgtggaactgggggccttgtgtcacttactatgggccccggagcccggggtgggccaagagcactttttca
tggaaacgctggatttcgtgcacacttccctgcgctgttcgaacccgccctggatggcttacaaaacgccgaacagagag
agcaggacgaaggcagaccagaagaaaaagaagaggatcgcgacgcagggattagcgtggaggttcagattggacgtaaa
ttacgtgaaatgggggatcagtttcagcaagagcatcttcagctgtttactcaaaggggccaaatgggtttgttccagct
catgacgtcgatctacaacttcctttttccccaagagagaccccaaaatgcaagagcccacagatga
>gnl|bcl2dbcds|Q0GKC4_uncBMF-02 Putative Bcl2 modifying factor gene OS=[Eukaryota] Danio rerio (length=681 residues).
atggatgatgaggaggatgaacagcttcctcgctgctgtgaaacgccgctaagaaacaagcgctcagagaagagagacgc
ccacggtggagacgtgggacaaacagctcacagacacgcatccacacagactgctggctctgtcctcaattcagcgagag
acgcagatatggcaccattccagggctcacagagagaagcatcatctctttgcagagttgtgggtgctaggactgcattc
agggctccctgtggaactgggggccttgtgtcacttactatgggccccggagcccggggtgggccaagagcactttttca
tggaaacgctggatttcgtgcacacttccctgcgctgttcgaacccgccctggatggcttacaaaacgccgaacagagag
agcaggacgaaggcagaccagaagaaaaagaagaggatcgcgacgcagggattagcgtggaggttcagattggacgtaaa
ttacgtgaaatgggggatcagtttcagcaagagcatcttcagctggtaagagtcattcacatcagactgattcttttctt
caaggccgctgggtttcagatgtgtgtggtcagaaactggtggtttcagtcacgatgcaaaatgacatcactgtctgcta
tttcagtgttgaatatgcaaattcccaagagggagcgatga
© 1998-2018