Dataset for CDS PMAIP1 of organism Danio rerio

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|Q0GKC8_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Danio rerio GN=PMAIP1 (length=138 residues).
atggcgaagaaagagcaaaccgctgtagtagagtgcgcgcagcagttgcgaaacattggagatctgttgaactggaaata
taagttactggagctcatagtaacactccagaaaatacaaatggaggggaagcgatga
© 1998-2018