Dataset for CDS classical BH3-containing proteins of organism Danio rerio

[Download (right click)] [Alignment] [Repertoires]

10 sequence(s)

>gnl|bcl2dbcds|A7MCM4_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Danio rerio GN=BAD (length=444 residues).
atggcacatatgtttaatatctccgatgattcagagacagaaacaatggaagacagtgaagcctcaagcctggataaaca
caagagtgggtcggcacagaaaaagcagcacctcactgttcctgataggctgaaaggagagcaactgggcagacagagga
acctctcgatgaatgaggaggacttgctggaaactggagttgcagaagatcctcatatgcttggggatcctttcaggccg
agatcccgctcagctcctcctgctttgtgggcagctaagaaatacggccaacagctgagaagaatgagtgatgagtttga
taaagggcagatgaagagagtaaaaagtgcaggaactgcgcgtcagatgagtcaatcgcccagctggttggcatttcttt
ggagtcacaaagagtctgatgcggagtcgcgccccgcagagtga
>gnl|bcl2dbcds|B2KKY9_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Danio rerio GN=BCL2L11 (length=531 residues).
atgtctgacacgtccagagagcaaacgctggccaatggcccggcctcgcagggaagcggagagagcaccggtggcggagt
ggtgttgcccgccgggcactttgatttccctcagccgggcgaaggggacccgttaaggggagggatatccatgtcgaata
accagtcgaggtcaccgatgaaccggactttctccaggtcctctagtggctatttttccgtcgacagcgattctgtgcca
ggttcccctctaatgcccaatatttccgaagcgcaagacggacaaaatgatgaggtatggttatcagaacatagccacca
gcacttgcagatggcagcaccagtcgcagccctgccgccggagatggtggtcgctcgtgaactgcgacgcataggcgatg
agttcaatcgcctctactgtgaggccggagcaggagtgaaccagctgcgtgctcccaacgaacacgccatcgtcctgtgg
atgaacgtcattatcggacgcctagtacactttttcctgcgaagaagatga
>gnl|bcl2dbcds|B8JK68_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Danio rerio GN=BCL2L11 (length=531 residues).
atgtctgacacgtccagagagcaaacgctggccaatggcccggcctcgcagggaagcggagagagcaccggtggcggagt
ggtgttgcccgccgggcactttgatttccctcagccgggcgaaggggacccgttaaggggagggatatccatgtcgaata
accagtcgaggtcaccgatgaaccggactttctccaggtcctctagtggctatttttccgtcgacagcgattctgtgcca
ggttcccctctaatgcccaatatttccgaagcgcaagacggacaaaatgatgaggtatggttatcagaacatagccacca
gcacttgcagatggcagcaccagtcgcagccctgccgccggagatggtggtcgctcgtgaactgcgacgcataggcgatg
agttcaatcgcctctactgtgaggccggagcaggagtgaaccagctgcatgctcccaacgaacacgccatcgtcctgtgg
atgaacgacattatcggacgcctagtacactttttcctgcgaagaagatga
>gnl|bcl2dbcds|E7FBJ6_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Danio rerio GN=BAD (length=438 residues).
atggagaacacctcgcatgaccatcaagatgattccagcaccttggatgaaaaagagagatcacatctgaaagggacaat
caagaaccatggacaacatcaggatcgaacatcggccaacatttctcctcaagggcgtgtgcggctctattcggaatctc
aagtgtatacagtcagccgctggcaggacacagagacccaggatggagcatcggtggaggagaacggagatggacttcca
ttcaggggtcgttctcaatcagcacctgctgcactgtggaaagcaaaaaagtatggccgtcagttgaggagaatgagcga
tgaattcgacacatggctcgataaaggggtgagtaagacaccgaacagccagaaacagacctaccgaggatggttttcgt
tcctctggagtcccaaagaagaagagggcagagaatga
>gnl|bcl2dbcds|Q0GKC7_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Danio rerio GN=BMF (length=429 residues).
atggatgaggacgaggatgatgtgttcaggaagggtctccagcactggcctcctccccacctgcagataaagcagactga
gttggcaggacgtcccgctgggtcacgcaacggtatgctgctctgccggcatctccagcagcacggacactttctctacg
gtaacgcagaattgctggttctagctgcgtccagccgcgctcagcctccagacgtggtgttacggcagaacgtctcaccg
atggagcgaccagagccccgacctgcacagagcgtggaaaccctcatcggacagaagctgcagctgattggagatcagtt
ctatcaggagcacatcatgcatcatcaaaggccgcaggatccgctgtggaggcgtgtggcgacggccgtcctcacgctgc
tgttcggcgccagagagaaccgcaggtga
>gnl|bcl2dbcds|Q0GKC8_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Danio rerio GN=PMAIP1 (length=138 residues).
atggcgaagaaagagcaaaccgctgtagtagagtgcgcgcagcagttgcgaaacattggagatctgttgaactggaaata
taagttactggagctcatagtaacactccagaaaatacaaatggaggggaagcgatga
>gnl|bcl2dbcds|Q4V925_BAD-03 BCL2-associated agonist of cell death gene OS=[Eukaryota] Danio rerio GN=BAD (length=441 residues).
atggcacatatgtttaatatctctgatgattcagagacagaaacaatggaagacagtgaagactcaagcctggataaaca
caagagtgggtcggcacagaaaaagcagcacctcactgttcctgataggctgaaaggagagcaactgggcagacagagga
acctctcgatgaatgaggaggacttgctggaaactggagttgcagaagatcctcatatgcttggggatcctttcaggccg
agatcccgctcagctcctcctgctttgtgggcagctaagaaatacggccaacagctgagaagaatgagtgatgagtttga
taaagggatgaagagagtaaaaagtgcaggaactgcgcgtcagatgagtcaatcgcccagctggttggcatttctttgga
gtcacaaagagtctgatgcggagtcgcgccccgcagagtga
>gnl|bcl2dbcds|Q4V925_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Danio rerio GN=BAD (length=441 residues).
atggcacatatgtttaatatctctgatgattcagagacagaaacaatggaagacagtgaagactcaagcctggataaaca
caagagtgggtcggcacagaaaaagcagcacctcactgttcctgataggctgaaaggagagcaactgggcagacagagga
acctctcgatgaatgaggaggacttgctggaaactggagttgcagaagatcctcatatgcttggggatcctttcaggccg
agatcccgctcagctcctcctgctttgtgggcagctaagaaatacggccaacagctgagaagaatgagtgatgagtttga
taaagggatgaagagagtaaaaagtgcaggaactgcgcgtcagatgagtcaatcgcccagctggttggcatttctttgga
gtcacaaagagtctgatgcggagtcgcgccccgcagagtga
>gnl|bcl2dbcds|Q4V925_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Danio rerio GN=BAD (length=444 residues).
atggcacatatgtttaatatctctgatgattcagagacagaaacaatggaagacagtgaagactcaagcctggataaaca
caagagtgggtcggcacagaaaaagcagcacctcactgttcctgataggctgaaaggagagcaactgggcagacagagga
acctctcgatgaatgaggaggacttgctggaaactggagttgcagaagatcctcatatgcttggggatcctttcaggccg
agatcccgctcagctcctcctgctttgtgggcagctaagaaatacggccaacagctgagaagaatgagtgatgagtttga
taaagggcagatgaagagagtaaaaagtgcaggaactgcgcgtcagatgagtcaatcgcccagctggttggcatttcttt
ggagtcacaaagagtctgatgcggagtcgcgccccgcagagtga
>gnl|bcl2dbcds|Q4V925_BAD-04 BCL2-associated agonist of cell death gene OS=[Eukaryota] Danio rerio GN=BAD (length=444 residues).
atggcacatatgtttaatatctctgatgattcagagacagaaacaatggaagacagtgaagactcaagcctggataaaca
caagagtgggtcggcacagaaaaagcagcacctcactgttcctgataggctgaaaggagagcaactgggcagacagagga
acctctcgatgaatgaggaggacttgctggaaactggagttgcagaagatcctcatatgcttggggatcctttcaggccg
agatcccgctcagctcctcctgctttgtgggcagctaagaaatacggccaacagctgagaagaatgagtgatgagtttga
taaagggcagatgaagagagtaaaaagtgcaggaactgcgcgtcagatgagtcaatcgcccagctggttggcatttcttt
ggagtcacaaagagtctgatgcggagtcgcgccccgcagagtga
© 1998-2018