Dataset for CDS BAD of organism Cyprinodon variegatus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3Q2D5S0_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Cyprinodon variegatus GN=BAD (length=492 residues).
atggctcagtcggtagagacttcggatcctattatggctgcaacctttaccatttcagacagcgacactgagccatcaga
ggaggtggaggaaacaagaaacaaggagccaaggatacgaaacagtgggaaaacacatcgtcggatcagactgagctcgg
agtctcacgctttcaccagagaggaggaggccaggggggaggaggaggtcgggacccccactgagggctatccattcagg
ggccgatctaattcagctcctccagctctgtgggctgccaagaagtacggccggcagcttcgaaggatgagtgatgagtt
tgtcaccctgcttgataaaggggagttgaggaaggtgagcagcacggggacgaacagaccaatacgccattccaagagct
ggtggagctacctcttcagtcaccaggagatggagggagagaacagtcaccatgaaaaccacacgcaatgcactgaacaa
agaggagaataa
© 1998-2019