Dataset for CDS Unclassified of organism Cynoglossus semilaevis

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A3P8UBL4_uncBCL2L11-01 Putative BCL2-like 11 gene OS=[Eukaryota] Cynoglossus semilaevis (length=351 residues).
atgagaagaaaaggcgagttcatttcagctcgtgcaccgacgggccgttcagtcgagtgtcagagagaaggagggagggc
ggaggagaggaaatctcctcagagcacagacaaaagagttaggagtttgtttaccgactccgtgccgagctccccgaggc
cagtgacggctgacaaagccacgcagactccgagtccctccgcccaggtgatcaatcacgccctgctgagcgtggccgag
acgcagcggacgaacggtgaacgactacgacagattcatccggaacgtgagtggcctctgacgtgtgtgtgtgtgtgtgg
gtttgtgtttttgtacctgtgtgggcgataa
>gnl|bcl2dbcds|A0A3P8W5W5_uncBMF-01 Putative Bcl2 modifying factor gene OS=[Eukaryota] Cynoglossus semilaevis (length=264 residues).
atgaaacaggaattcagaataaagccagagtatacagaaaacatgatgaataaattattatttacaccctcactgttaag
ctgccctggcagtcgtatttgcttgtttcctctgaggcattgttgtgggggatgcaacactgaaagccagttggaaatgg
tttgtcctccatttcaactttcagcattttccactgcctgtccagtcgtgcttcctttgactcctctgactcaatcaaga
cgtgaggattctcgttggtattga
© 1998-2019