Dataset for CDS BMF of organism Cynoglossus semilaevis

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A3P8UA78_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Cynoglossus semilaevis GN=BMF (length=522 residues).
atggatgacgaggaggacgatgtctttgagccagacccgcacagctggcacacaacattcagggagataaggtgtgaaga
ccggggcacacagacacctggtccagacctggcactgaacaacggcatgctgccctgtggggtgggagaggagcccagac
cactcttctacggcaacgcaggctttcgattgcacttcccagctcactttgagctaattggagatcgggaaacaaggaga
agacaaagtgacgaggagcgaaataggatggagccgcggccccagcagcagcagcagcagcagcggcagcagcagcagca
gcctgtgcagcgcagcgtggaggtccgcattggccagaaactccagctaataggagaccagttccaccgggatcatctgc
agctgtatcatcgaaaccaaaggaaccacgggccgctgtggtggcgcctgaccacaactctgctcagccttctgttcaac
agagggttctttgctgggggaggcgcagcgggacggaggtga
>gnl|bcl2dbcds|A0A3P8UA78_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Cynoglossus semilaevis GN=BMF (length=522 residues).
atggatgacgaggaggacgatgtctttgagccagacccgcacagctggcacacaacattcagggagataaggtgtgaaga
ccggggcacacagacacctggtccagacctggcactgaacaacggcatgctgccctgtggggtgggagaggagcccagac
cactcttctacggcaacgcaggctttcgattgcacttcccagctcactttgagctaattggagatcgggaaacaaggaga
agacaaagtgacgaggagcgaaataggatggagccgcggccccagcagcagcagcagcagcagcggcagcagcagcagca
gcctgtgcagcgcagcgtggaggtccgcattggccagaaactccagctaataggagaccagttccaccgggatcatctgc
agctgtatcatcgaaaccaaaggaaccacgggccgctgtggtggcgcctgaccacaactctgctcagccttctgttcaac
agagggttctttgctgggggaggcgcagcgggacggaggtga
>gnl|bcl2dbcds|A0A3P8UA78_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Cynoglossus semilaevis GN=BMF (length=522 residues).
atggatgacgaggaggacgatgtctttgagccagacccgcacagctggcacacaacattcagggagataaggtgtgaaga
ccggggcacacagacacctggtccagacctggcactgaacaacggcatgctgccctgtggggtgggagaggagcccagac
cactcttctacggcaacgcaggctttcgattgcacttcccagctcactttgagctaattggagatcgggaaacaaggaga
agacaaagtgacgaggagcgaaataggatggagccgcggccccagcagcagcagcagcagcagcggcagcagcagcagca
gcctgtgcagcgcagcgtggaggtccgcattggccagaaactccagctaataggagaccagttccaccgggatcatctgc
agctgtatcatcgaaaccaaaggaaccacgggccgctgtggtggcgcctgaccacaactctgctcagccttctgttcaac
agagggttctttgctgggggaggcgcagcgggacggaggtga
© 1998-2019