Dataset for CDS BAD of organism Cynoglossus semilaevis

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A3P8WIZ8_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Cynoglossus semilaevis GN=BAD (length=537 residues).
atgaatgtagaagtgtccatctttccagatgtcacaatggctgcacagttcactatatcggacagcgaatccgagccgga
ggaggaagtcgagggaggaaaaattaagcattcattgaatgacccagaacaggttgtacctcaccggcacaacctcaccc
tacctgagctcagggtggcaggaagtcgtcggatcaggctaaattcagagtcacatgcttcaaccatttccagagaggaa
gccttccagtcctggggggaggaagaagccggaacgcccacagaaggagctcctttcaggggacggtccaggtcagctcc
tcctgccctgtgggcagcaaagaagtatggcaggcagctccgcaggatgagtgatgaatttgacagcctgctggacaaag
ggatgaggaaggtgaagagcgcaggcacagccagacagatgcaccactccaaaagctggtggagctacctctttagtcac
caggagctggaaggagaaaacaaccatcacgagaaccacactcaccgcactgagtag
>gnl|bcl2dbcds|A0A3P8WIZ8_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Cynoglossus semilaevis GN=BAD (length=501 residues).
atggctgcacagttcactatatcggacagcgaatccgagccggaggaggaagtcgagggaggaaaaattaagcattcatt
gaatgacccagaacaggttgtacctcaccggcacaacctcaccctacctgagctcagggtggcaggaagtcgtcggatca
ggctaaattcagagtcacatgcttcaaccatttccagagaggaagccttccagtcctggggggaggaagaagccggaacg
cccacagaaggagctcctttcaggggacggtccaggtcagctcctcctgccctgtgggcagcaaagaagtatggcaggca
gctccgcaggatgagtgatgaatttgacagcctgctggacaaagggatgaggaaggtgaagagcgcaggcacagccagac
agatgcaccactccaaaagctggtggagctacctctttagtcaccaggagctggaaggagaaaacaaccatcacgagaac
cacactcaccgcactgagtag
© 1998-2019