Dataset for CDS classical BH3-containing proteins of organism Ctenopharyngodon idella

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A0P0HZF9_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Ctenopharyngodon idella GN=PMAIP1 (length=138 residues).
atggcgaagaaagagaaaaccgctgttgtcgagtgcgcgcaacagttgcgcacaattggagatctctttgactggaaata
caagttactggaaatcataatcgcgctccagaaagcgcagacggacggaaaaagatga
© 1998-2018