Dataset for CDS classical BH3-containing proteins of organism Colobus angolensis palliatus

[Download (right click)] [Alignment] [Repertoires]

17 sequence(s)

>gnl|bcl2dbcds|A0A2K5HKW9_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Colobus angolensis palliatus GN=BAD (length=489 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagcccggc
aggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
aggcaaccagcagcagccatcatggagggagagcttggtattctccttctgaatctgaggactctgaaaatcccagtgca
aggatgctcacggaagcatcagcagggatgtctgccccagccactgactcagaagcccaacacgcagagaatgtaaagct
ggaggcgctggggctgtggagacccggagtcgccacagctcccaccccgcggggacggaggaggacgaagggatggagga
ggagcccagcccctttcggggccgctcgcgctccgcgccccctaacctctgggcagcacagcgatatggccgcgagctcc
ggaggatga
>gnl|bcl2dbcds|A0A2K5HKW9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Colobus angolensis palliatus GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagcccggc
aggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
aggcaaccagcagcagccatcatggaggcgctggggctgtggagacccggagtcgccacagctcccaccccgcggggacg
gaggaggacgaagggatggaggaggagcccagcccctttcggggccgctcgcgctccgcgccccctaacctctgggcagc
acagcgatatggccgcgagctccggaggatgagtgacgagtttgtggactcttttaagggacttcctcgcccgaagagcg
cgggcacagcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcagg
ggaagctccgccccctcccagtga
>gnl|bcl2dbcds|A0A2K5HZI7_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatgggtgttt
ttgaataa
>gnl|bcl2dbcds|A0A2K5HZI7_BCL2L11-10 BCL2-like 11 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L11 (length=339 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggtagtcatcctagaggatataggtgat
acttcattgtggtttggatttatatttactggcttagatttgtatggccaccaccacagtcaagatacagaacaactcaa
ccacagggatttctcatga
>gnl|bcl2dbcds|A0A2K5HZI7_BCL2L11-09 BCL2-like 11 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L11 (length=267 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggatgaggccactggatcctccctcaga
attgcccttcatagggaagttcagtag
>gnl|bcl2dbcds|A0A2K5HZI7_BCL2L11-05 BCL2-like 11 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L11 (length=423 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggttagag
aaatagaggaagttgtcgtgtag
>gnl|bcl2dbcds|A0A2K5HZI7_BCL2L11-06 BCL2-like 11 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L11 (length=510 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggttagagaaatag
>gnl|bcl2dbcds|A0A2K5HZI7_BCL2L11-08 BCL2-like 11 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L11 (length=408 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggctaact
gggactag
>gnl|bcl2dbcds|A0A2K5HZI7_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L11 (length=417 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccaggaggcaggctgaacctgca
gatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttactatgcaaggagggt
gtttttgaataattaccaagcagccgaagaccacccacaaatggttatcttacgactgttgcgttacattgtccgcctgg
tgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K5HZI7_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L11 (length=597 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggagggtgtttttgaataattaccaagcagccgaagaccacccacaaatggttatcttacgactgtt
gcgttacattgtccgcctggtgtggagaatgcattga
>gnl|bcl2dbcds|A0A2K5HZI7_BCL2L11-04 BCL2-like 11 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L11 (length=519 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaaggtaatcccgaaggcaatcacggaggtgaaggggaca
gctgcccccacggcagccctcagggcccgctggccccaccggccagccctggcccttttgctaccagatccccgcttttc
atctttatgagaagatcctccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccagcacc
catgagttgtgacaaatcaacacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttcca
ggaggcaggctgaacctgcagatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaac
gcttactatgcaaggaggatgtctcttccacctgattaa
>gnl|bcl2dbcds|A0A2K5HZI7_BCL2L11-07 BCL2-like 11 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L11 (length=258 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagaaccacaagcttccaggaggcaggctgaacctgcagatatgcgcc
cggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttactatgcaaggaggttggcaaaactc
ctggcatcctccacctga
>gnl|bcl2dbcds|A0A2K5J4Q7_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Colobus angolensis palliatus GN=BIK (length=483 residues).
atgtctggagtaagacccatctccagagacatcttgatggagaccctcctgtatgagcagctcctggaacccctaaccat
ggaggttcttggtgtgactgaccctgaagaggacctggaccctatggaggacttcgatcctttggagtgtatggaggaca
gtgacatgttggccctgcggctggcctgcatcggggatgagatggacgtgagcctcagggccccgcgcctggcccagctc
tctgaggtggccatgcacagcctgggtctggctttcatctacgaccagaccgacgacatcagggatgttcttagaagttt
catggacggcttcaccacccttaaggagaacataatgaggttctggagatccccgaatcccgggtcccgggtgtcccgcg
aacaggtgctgctggcgctgctgctgctgctggcactgctgctggcgctgctcagcgggggcctgcacctgctgctcaag
tga
>gnl|bcl2dbcds|A0A2K5JY52_PMAIP1-02 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Colobus angolensis palliatus GN=PMAIP1 (length=372 residues).
atgcctgggaagaaggcgcgcaagaacgcgcaaccgagcccagcgcgggctcaggcaggtactgacccgctggggccagc
gaagacccaggctgggcggggtcggggccggggcaaaaagctcctctcctccccacttgcccttccgcggggccacgagg
aacaagtgcaagtagctcgaagtcgagtgtgctactcaactcaggagatttggagacaaactgaacttccggcagaaact
tctgaatctgatagccaaactcttctgctcaggaacctgactgcaacaaaaacttgcatgaggggactccaaaagagaat
ttttctcaggaggtgcacatttcatcaatttgaagcaagattgcattgtaat
>gnl|bcl2dbcds|A0A2K5JY52_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Colobus angolensis palliatus GN=PMAIP1 (length=165 residues).
atgcctgggaagaaggcgcgcaagaacgcgcaaccgagcccagcgcgggctcaggcagagctcgaagtcgagtgtgctac
tcaactcaggagatttggagacaaactgaacttccggcagaaacttctgaatctgatagccaaactcttctgctcaggaa
cctga
>gnl|bcl2dbcds|A0A2K5KGR6_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Colobus angolensis palliatus GN=BMF (length=507 residues).
atggagccatctcggtgtgtggaggagctggaggatgacgtgttccagccggaggacggggagccgggggcccaacccgg
gagctcgctctctgccgatctgtttgcccagagcttacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggctacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtaactgaggaaccccagcgactgttttatgcaccagcagaaccgaaatcgcgtgtggt
ggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcgggccccaggtgaggctgg
gctgccctcttcacatggggcaccaggaacaccgtcaggaaggacatcgggcaggactgacactgtgtcttgtgaagttg
tttttttgttgttattttgcgttttaa
>gnl|bcl2dbcds|A0A2K5KGR6_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Colobus angolensis palliatus GN=BMF (length=555 residues).
atggagccatctcggtgtgtggaggagctggaggatgacgtgttccagccggaggacggggagccgggggcccaacccgg
gagctcgctctctgccgatctgtttgcccagagcttacttgactgccccctcagccgacttcagctcttccctctcaccc
actgctgtggccctggccttcgacccaccagccaggaagacaaggctacccagaccctcggcccagcctcccccagccaa
ggtgtcatgctgccttgtggggtaactgaggaaccccagcgactgttttatggcaatgctggctaccggcttcctctccc
tgccagtttcccggcagtcttgcccatcggggagcagccccccgaagggcagtggcaacatcgagcagaggtacagattg
cccgaaagcttcagtgcattgcagaccagttccaccggcttcatgtgcagcaacaccagcagaaccgaaatcgcgtgtgg
tggcagatcctcctcttcctgcacaaccttgctttgaatggagaagagaacaggaacggggcgggccccaggtga
© 1998-2018