Dataset for CDS BIK of organism Colobus angolensis palliatus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A2K5J4Q7_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Colobus angolensis palliatus GN=BIK (length=483 residues).
atgtctggagtaagacccatctccagagacatcttgatggagaccctcctgtatgagcagctcctggaacccctaaccat
ggaggttcttggtgtgactgaccctgaagaggacctggaccctatggaggacttcgatcctttggagtgtatggaggaca
gtgacatgttggccctgcggctggcctgcatcggggatgagatggacgtgagcctcagggccccgcgcctggcccagctc
tctgaggtggccatgcacagcctgggtctggctttcatctacgaccagaccgacgacatcagggatgttcttagaagttt
catggacggcttcaccacccttaaggagaacataatgaggttctggagatccccgaatcccgggtcccgggtgtcccgcg
aacaggtgctgctggcgctgctgctgctgctggcactgctgctggcgctgctcagcgggggcctgcacctgctgctcaag
tga
© 1998-2018