Dataset for CDS BAD of organism Colobus angolensis palliatus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A2K5HKW9_BAD-02 BCL2-associated agonist of cell death gene OS=[Eukaryota] Colobus angolensis palliatus GN=BAD (length=489 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagcccggc
aggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
aggcaaccagcagcagccatcatggagggagagcttggtattctccttctgaatctgaggactctgaaaatcccagtgca
aggatgctcacggaagcatcagcagggatgtctgccccagccactgactcagaagcccaacacgcagagaatgtaaagct
ggaggcgctggggctgtggagacccggagtcgccacagctcccaccccgcggggacggaggaggacgaagggatggagga
ggagcccagcccctttcggggccgctcgcgctccgcgccccctaacctctgggcagcacagcgatatggccgcgagctcc
ggaggatga
>gnl|bcl2dbcds|A0A2K5HKW9_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Colobus angolensis palliatus GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagcccggc
aggggacaggccctcagactccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
aggcaaccagcagcagccatcatggaggcgctggggctgtggagacccggagtcgccacagctcccaccccgcggggacg
gaggaggacgaagggatggaggaggagcccagcccctttcggggccgctcgcgctccgcgccccctaacctctgggcagc
acagcgatatggccgcgagctccggaggatgagtgacgagtttgtggactcttttaagggacttcctcgcccgaagagcg
cgggcacagcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcagg
ggaagctccgccccctcccagtga
© 1998-2018