Dataset for CDS BIK of organism Chlorocebus sabaeus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A0D9QZY8_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Chlorocebus sabaeus GN=BIK (length=480 residues).
atgtctggagtaagacccatctccagacacatcttgatggagagcctcctgtatgagcagctcctggaacccctgaccat
ggaggttcttggtgtgactgaccctgaagaggacctggaccctatggaggacttcgatcctttggagtgtatggaggaca
gtgacatgttggccctgcggctggcctgcatcggggacgagatggacgtgagcctcagggccccgcgcctggcccagctc
tctgaggtggccatgcacagcctgggtctggctttcatctacgaccagacggacgacatcagggatgttcttagaagttt
catagatggtttcaccacccttagggagaacataatgaggttctggagatccctgaatcccgggtcctgggtgtcccgcg
aacaggtgctgctggcgctgctgctgctggcactgctgctggcgctgctcagcgggggcctgcacctgctgctcaagtga
© 1998-2018