Dataset for CDS BCL2L11 of organism Chlorocebus sabaeus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A0D9RWE0_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Chlorocebus sabaeus GN=BCL2L11 (length=330 residues).
atggcaaagcaaccttctgatgtaagttctgagtgtgaccgagaaggtagacaattgcagcctgcggagaggcctcccca
gctcagacctggggcccctacctccctacagacagagccacaagacaggagcccagcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccactatctcagtgcaatggcttccaggaggcaggctgaacctgca
gatatgcgcccggagatacggatcgcccaagagttgcggcgaatcggagacgagtttaacgcttactatgcaaggaggtt
agagaaatag
© 1998-2018