Dataset for CDS BAD of organism Chlorocebus sabaeus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A0D9R491_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Chlorocebus sabaeus GN=BAD (length=504 residues).
atgttccagatcccagagtttgagcctagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgc
agggaacaggccctcagactccggcaagcatcatcaccaggccccaggcctcctgtgggacgccagtcaccagcaggagc
agccaaccagcagcagccatcatggaggcgctggggctgtggagacccggagtcgccacagctcctaccccgcggggacg
gaggaggacgaagggatggaggaggagcccagccccttccggggccgctcgcgctccgcgccccccaacctctgggcagc
acagcgttatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagggacttcctcgcccgaagagcg
cgggcacagcgacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcagg
ggaagctccgccccctcccagtga
© 1998-2018