Dataset for CDS classical BH3-containing proteins of organism Cavia porcellus

[Download (right click)] [Alignment] [Repertoires]

9 sequence(s)

>gnl|bcl2dbcds|A0A286XF37_PMAIP1-01 Phorbol-12-myristate-13-acetate-induced protein 1 gene OS=[Eukaryota] Cavia porcellus GN=PMAIP1 (length=309 residues).
atgcctggaaaggtgtgtaagagcgcgcagccgaactccacgcgggcagagctagaagttgagtgtgctgcccagctcag
gagagttggagacacactgaattccctgggttgcaccacggaggccttggaggtgcttgcagagatggctgggaagaagg
cgcggaagagctcggagccggatccggcacgggcgcgcgcggagctggaagtcgagtgtgctgctcagttgagaagaatt
ggagataaactgaatttccagcagaaacttatgtatttgatttccaaactcatcagtttggtaacctga
>gnl|bcl2dbcds|A0A286XJN2_BCL2L11-01 BCL2-like 11 gene OS=[Eukaryota] Cavia porcellus GN=BCL2L11 (length=591 residues).
atggccaagcaaccttccgatgtaagttgtgagtgtgacagagaaggtggacaattgcagcctgctgagaggccatccca
gctcagggctggggccccaacctccctacagacggagccccaaggtaatcctgaaggcgcaggggaccgctccccccacg
gcagccctcagggcccgctggccccaccggccagtcctggcccttttgctaccagatccccgctattcatctttgtgaga
agatcttccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctggacctccgcatttgcgcccagagatatggatcgcacaggaattgcgtcgcatcggagatgagtttaatgcctcg
tacccaaggcgggtgttcttgaatcattaccagcccgctgaagaccaaccccaaatggttatcttgcgattgttacgtta
cattatccgcctggtatggcgaatgcattga
>gnl|bcl2dbcds|A0A286XJN2_BCL2L11-03 BCL2-like 11 gene OS=[Eukaryota] Cavia porcellus GN=BCL2L11 (length=591 residues).
atggccaagcaaccttccgatgtaagttgtgagtgtgacagagaaggtggacaattgcagcctgctgagaggccatccca
gctcagggctggggccccaacctccctacagacggagccccaaggtaatcctgaaggcgcaggggaccgctccccccacg
gcagccctcagggcccgctggccccaccggccagtcctggcccttttgctaccagatccccgctattcatctttgtgaga
agatcttccctgctgtctcgatcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtga
caaatcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctc
aggctggacctccgcatttgcgcccagagatatggatcgcacaggaattgcgtcgcatcggagatgagtttaatgcctcg
tacccaaggcgggtgttcttgaatcattaccagcccgctgaagaccaaccccaaatggttatcttgcgattgttacgtta
cattatccgcctggtatggcgaatgcattga
>gnl|bcl2dbcds|A0A286XJN2_BCL2L11-02 BCL2-like 11 gene OS=[Eukaryota] Cavia porcellus GN=BCL2L11 (length=423 residues).
atggccaagcaaccttccgatgtaagttgtgagtgtgacagagaaggtggacaattgcagcctgctgagaggccatccca
gctcagggctggggccccaacctccctacagacggagccccaagacaggagcccggcacccatgagttgtgacaaatcaa
cacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccatgaggcagtctcaggctgga
cctccgcatttgcgcccagagatatggatcgcacaggaattgcgtcgcatcggagatgagtttaatgcctcgtacccaag
gcgggtgttcttgaatcattaccagcccgctgaagaccaaccccaaatggttatcttgcgattgttacgttacattatcc
gcctggtatggcgaatgcattga
>gnl|bcl2dbcds|A0A286XXB0_BMF-03 Bcl2 modifying factor gene OS=[Eukaryota] Cavia porcellus GN=BMF (length=570 residues).
gttttcccaagggagatggagccacctcagtgtgtggaggagctggaggatgatgtgttccaacccgaggatggggagcc
ggggacccagcctgggagcctgctctctgctgatctctttgcccagagccagctggactgtccccttggtcggctgcacc
tctttcctctcacccactgctgtggccctgggcttcgccccaccagccaggaagacaaggccactcagaccctcagccca
tcctctccaagccagggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggcta
ccggcttcctctccctgccagtttccctgcaggcttgccccttggggagcagccccctgaaggtcagtggcaacatcgag
cagaggtacagatcgcccggaagcttcagtgcattgcagaccagttccaccgacttcacattcaacaacaccaacagaac
cggaatcgcgcatggtggcaggtcttactcttcatgcacaacctgggtctgaacggagaagagaacagggaaggggcagg
tcccaggtga
>gnl|bcl2dbcds|A0A286XXB0_BMF-02 Bcl2 modifying factor gene OS=[Eukaryota] Cavia porcellus GN=BMF (length=711 residues).
atgcccggggcgggcgtattttggaaacaataccgcgcgcgccgccgccgccgcggacccgaccccccccgagtgttcgt
cacgctggaccctggcacagagccctggcaccacgactcggaggccgattctctctcctggagtcacccaggggagatgg
agccacctcagtgtgtggaggagctggaggatgatgtgttccaacccgaggatggggagccggggacccagcctgggagc
ctgctctctgctgatctctttgcccagagccagctggactgtccccttggtcggctgcacctctttcctctcacccactg
ctgtggccctgggcttcgccccaccagccaggaagacaaggccactcagaccctcagcccatcctctccaagccagggtg
tcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggctaccggcttcctctccctgcc
agtttccctgcaggcttgccccttggggagcagccccctgaaggtcagtggcaacatcgagcagaggtacagatcgcccg
gaagcttcagtgcattgcagaccagttccaccgacttcacattcaacaacaccaacagaaccggaatcgcgcatggtggc
aggtcttactcttcatgcacaacctgggtctgaacggagaagagaacagggaaggggcaggtcccaggtga
>gnl|bcl2dbcds|A0A286XXB0_BMF-01 Bcl2 modifying factor gene OS=[Eukaryota] Cavia porcellus GN=BMF (length=555 residues).
atggagccacctcagtgtgtggaggagctggaggatgatgtgttccaacccgaggatggggagccggggacccagcctgg
gagcctgctctctgctgatctctttgcccagagccagctggactgtccccttggtcggctgcacctctttcctctcaccc
actgctgtggccctgggcttcgccccaccagccaggaagacaaggccactcagaccctcagcccatcctctccaagccag
ggtgtcatgctgccttgtggggtgactgaggaaccccagcgactcttttatggcaatgctggctaccggcttcctctccc
tgccagtttccctgcaggcttgccccttggggagcagccccctgaaggtcagtggcaacatcgagcagaggtacagatcg
cccggaagcttcagtgcattgcagaccagttccaccgacttcacattcaacaacaccaacagaaccggaatcgcgcatgg
tggcaggtcttactcttcatgcacaacctgggtctgaacggagaagagaacagggaaggggcaggtcccaggtga
>gnl|bcl2dbcds|H0V608_BAD-01 BCL2-associated agonist of cell death gene OS=[Eukaryota] Cavia porcellus GN=BAD (length=501 residues).
atgttccagatcccagagtttgagccaagtgagcaggaagactccagctctgaagagaggggcctgggccccagccccac
aggggacgagctaggcagcagcccagcaggaggcttcctgggggacaccagtcaccagcagaggcagctgagaagcagca
ggagccaccatggaggcactgtggctatggagacccggagtcgccaccggtcttatcctgcagggactgaggaggaggaa
gggatggaggaggagctcagtccattccggggccgctcgcgctcggcgccacccaacctctgggctgcacagcgctacgg
ccgagagctccggaggatgagcgacgagttcgtggactccttcaagggtcttcctcgcccgaagagcgcgggcacagcga
cgaagctgtggcagaactctaattggacacgggccatccagtcctggtgggatcggaacttggggagaggaggctccgcc
ccctcccaggagtcggtctga
>gnl|bcl2dbcds|H0W025_BIK-01 BCL2-interacting killer gene OS=[Eukaryota] Cavia porcellus GN=BIK (length=477 residues).
atgtcggaagcaaaacctgtcgccagggacccactgatggagaccccgctgtttgagccaccccctgggcctctgctggc
tgaaggggctttgggtgtgacgcagccactgtgggcagaggacctcagtccccctggggacactaacctcatggaatgcg
tggaaggcagcagcctggtggccctgcggctggcctgcatcggtgacgagatggacctgcgcctacggagcccccgcctg
gcccagctgccagggagggcagtgcacagcctggccatcacttacagccagatggggctctggggtgtgctcggaaggct
gaccctcagtctcgccagcctcagggacaatgtgtgggcctgtggacgcccagcctcccgtgcctgggtgtccccccgct
ggacctgcaggtggctgctgcctgtgctgctgttgctgctgctgctgctggggaccctgcgcctgctgctgcagtga
© 1998-2018